Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"

• HOME
• TEAM
• PROJECT
  • Description
  • Experiments & Protocols
  • Results
  • Design
• PARTS
  • Team Parts
  • Basic Parts
  • Composite Parts
  • Part Collection
• NOTEBOOK
  • Vitamin A
  • Vitamin B2
  • Vitamin B12
  • Manufacturing
  • Riboswitch
• ATTRIBUTIONS
• COLLABORATIONS
• HUMAN PRACTICES
• SAFETY
• MODELING
• MEASUREMENT
• SOFTWARE
• ENTREPRENEURSHIP

13/07

• Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.
Dilution in water and PCR amplification, using the following protocol:
• 1 μL gBlock (0.1 to 1ng)
• 1 μL forward primer (10 μM)
• 1 μL reverse primer (10 μM)
• 22 μL DNAse/RNAse free water
• 25 μL LifeTech MasterMix (2X)

RibA + o15.001 (GCGCCCGAAGACTTATGCAG) + o15.002(GGCCCCGCGCATATGAAG)
RibD + o15.003(CGCTATAGAAGACTTGAGAAGATCTG) + o15.004(GCGCGGCACCACATATGAAG)
RibE + o15.005(CGGCTATAGAAGACTTGCGC) + o15.006(CGCGCCGGCATATGAAGA)
RibT25 + o15.007(CCGCGTATAGAAGACTGCTAGA) + o15.008(CAGCAGCATATGAAGACAACCC)
RibT48 + o15.009(GCGGTATAGAAGACTGCTAGAGA) + o15.010(CAGCAGCATATGAAGACAACCC)

For each PCR reaction, a negative control without matrix DNA was prepared.


12 cycles amplification, using the following parameters:

time (min)	temperature (°C)	function
3:00	98	melting
0:30	98	melting
0:30	52	annealing
1:00	72	extension
10:00	72	extension
forever	12	storage

PCR purification using QIAGEN kit

PCR purification protocol Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down Transfer in a centrifugation column Centrifuge 1 min at 14000 rpm Throw the filtration product Add 700μL of washing solution Centrifuge 1 min at 14000 rpm Throw the filtration product Add 500μL of washing solution Centrifuge 1 min at 14000 rpm Throw the filtration product Centrifuge 1 min at 14000 rpm Throw the filtration product Put the column in a sterile 1.5mL microcentrifuge tube Add 45μL of DNAse/RNAse free water on the membrane Wait 2 minutes Centrifuge 2min at 10000rpm Discard the column, DNA is saved in water

Concentrations measured with a Nanodrop:

	[PCR product with gBlock] (ng/μL)	[PCR product without gBlock] (ng/μL)
RibA	3.5	3.4
RibD	6.4	3.3
RibE	5.0	3.7
RibT25	3.5	3.8
RibT48	8.7	3.3

Almost no difference between the PCR and their corresponding negative control.
It could be the fallout of the limited number of cycles. (We only used 12 cycles, as advised by IDT)
NEB Tm calculator gave really different Tm for the PCR primers than Geneious and IDT.
We decided to launch two PCR, both with 35 cycles, but with two different annealing
temperature: 52 and 64°C.

14/07
Launched the two different PCR with different Tm.

PCR with high annealing temperature, 35 cycles:

time (min)	temperature (°C)	function
3:00	98	melting
0:30	98	melting
0:30	64	annealing
1:00	72	extension
10:00	72	extension
forever	12	storage

PCR with low annealing temperature, 35 cycles:

time (min)	temperature (°C)	function
3:00	98	melting
0:30	98	melting
0:30	64	annealing
1:00	72	extension
10:00	72	extension
forever	12	storage

After PCR, we ran the PCR products on a TAE - 1% agarose gel (100V, 20min) to check
if the amplification product correspond to the expected size of the gBlocks.

From left to right: 1kb Ladder, RibA, D, E, T25 and T48 amplified at 52°C and Rib A, D, E, T25 and T48 amplified at 64°C

The bands are not really specific and seems to be smeared over the gel.
However, we can see that the extremity of each band correspond approximatively
to the expected size of our parts, except RibD amplified at 64°C for which no band has been detected. We purified our PCR product according to the previously used protocol,
and then measure the DNA concentration using a Nanodrop.

Part Name	PCR product amplified at 52°C concentration (ng/μL)	PCR product amplified at 64°C concentration (ng/μL)
RibA	54.3	132.7
RibD	50.5	140.2
RibE	67.1	78.2
RibT25	63.6	136.0
RibT48	61.2	143.1

16/07
Annealing of o15.011 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAT) and o15.012 (CTAGATCCCCCAAGTCTTCGAAGACAAGCATGG) using the following protocol:

Annealing Protocol Phosphorylation of the oligos 5.6μL DNAse/RNAse free water 6.0μL o15.011 (10µM) 6.0μL o15.012 (10µM) 2.0μL 10X T4 DNA ligase buffer 0.4μL T4 PolyNucleotide Kinase Total: 20μL incube 30min at 37°C add 1μL of 1M NaCl incube 5min at 95°C let the mix cool down use 2μL of the mix as a 10X solution

Inoculate LB + erythromycin (150ng/μL) with g15.21 containing pKV6.
Inoculate M17 + erythromycin (10ng/μL) with g15.13 containing pSIP411.
17/07
Miniprep of g15.13 and g15.21 as describe below:

Miniprep protocol using a QIAGEN kit centrifuge an overnight culture of cells 10min at 4krpm throw the filtrate resuspend the pellet in 250μL of Cell Resuspension Solution then mix it transfer it in a 1.5mL microcentrifuge tube add 250mL of Cell lysis solution and mix by inverting several times incube until the liquid is clear, maximum 5min add 10μL of Alkalyne protease solution, mix by inverting several times and incube 3 to 4 min add 350μL of Neutralisation Solution and mix by inverting several times centrifuge 10min at 14krpm add the supernatant in a column centrifuge 1min, 14krpm, then throw the filtrat add 750μL Washing Solution centrifuge 1min, 14krpm, then throw the filtrat add 250μL Washing Solution centrifuge 2min, 14krpm, then throw the filtrat centrifuge 1min, 14krpm transfer the column in a sterile microcentrifuge 1.5ml tube add 50μL of DNAse/RNAse free water right on the membrane of the filter, wait 1min centrifuge 1min, 14krpm throw the column, plasmid is saved in water

As g15.13 is a gram positive bacteria, we added 1mL of 10mg/mL Lysozyme at the same time that the cell lysis solution.
Measurement of DNA concentration

20/07

-Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously.
-PCR of pSIP411 ORI and resistance cassette (erythromycin) using o15.070 and o15.071.
We will call it pSIPnew to write clearer explanations.
The size of this fragment is 3.1kb, so the elongation phase was extended to 2min.
a negative PCR control was made at the same time (without matrix DNA).
PCR purification after the PCR and concentration measurement:

	Concentration (ng/μL)
pSIPnew	99.0
negative control	0.0

21/07

Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol.

Digestion Protocol Prepare the following mix: 4μL of Enzyme 1 4μL of Enzyme 2 4μL of FastAP 12μL of Fast Digest buffer 10X 1 to 3 μg of DNA up to 120μL of water mix by pipetting up and down incube 10min at 37°C

For pSIPnew: SalI and XbaI, 30μL of DNA (99ng/μL), 66μL of water.
For pKV6: SalI and EcoRI, 10μL of DNA(270ng/μL), 86μL of water.

PCR purification of both digested pKV6 and pSIPnew
Measure the DNA concentration after PCR purification:

	Concentration (ng/μL)
pSIPnew	60.8
pKV6	26.4

Ligation of annealed oligos o15.011 and o15.012 with digested pSIP411new and o15.072 and o15.073 with digested pKV6 using the following protocol

Ligation Protocol Mix the following vector 100ng insert 300ng T4 DNA ligase buffer 10X T4 DNA ligase up to 20µL of water incubate 30 to 40 minutes at room temperature

For pKV6: 4µL of digested pKV6(26.4ng/µL), 7µL of annealed o15.072/o15.073, 6µL of water.
For pSIPnew: 2µL of digested pKV6(60.8ng/µL), 6µL of annealed o15.011/o15.012, 9µL of water.

pKV6 ligated with o15.072/o15.073 and pSIPnew ligated with o15.011/o15.012 will be respectively called p15.01 and p15.02.

Transformation of p15.01, p15.02, pKV6(miniprep), pSIP411(miniprep) and a negative control (no DNA) in NEB DH5α chemically competent cells

Heat Shock transformation protocol Thaw frozen chemically competent cells (20µL aliquots) on ice for 10min. add 2µL of ligation product (or 0.5µL of miniprep) and incubate the cells 30sec at 42°C. put the cells back on ice for 2min. add 200µL of LB to the cells and incubate 2 hours at 37°C. plate the cells on LB + erythromycin (150µg/mL) or LB + erythromycin (10µg/mL), incubation at 37°C overnight.

22/07

Transformation results

Transformed product	pKV6	pSIP411	p15.01	p15.02	negative control
Growth Results	(ery 150µg/mL): 500 colonies, no background	(ery 10µg/mL): no growth (ery 150µg/mL): lawn of bacteria	spreading of 170µL: 41 isolated colonies -> isolation of three transformants: T1, T2 and T3 spreading of 50µL: 3 colonies on a lawny background	(ery 10µg/mL): lawn of bacteria (ery 150µg/mL): lawny background	no growth

23/07

Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL.

Electrocompetent Cells Preparation Protocol Inoculate two 250mL LB flasks with 100µL of an overnight culture of DH5α incubate until the the DO600 reach 0.5 to 0.7 place the cultures on ice for 15 minutes pour the culture in cold sterile 50mL falcon tubes centrifuge them for 10 minutes at 6000rpm throw the supernatant resuspend the cells in 50mL cold distilled water centrifuge them for 10 minutes at 6000rpm throw the supernatant resuspend the cells in 25mL cold distilled water centrifuge them for 10 minutes at 6000rpm throw the supernatant resuspend the cells in 12.5mL cold 10% glycerol centrifuge them for 10 minutes at 6000rpm throw the supernatant resuspend the cells in 5mL cold 10% glycerol make aliquots of the desire volume in microcentrifuge tubes and freeze them at -80°C

overnight cultures of 3 p15.01 transformants.

24/07

Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).
Digestion of pKV6(negative control) and p15.01 with BbsI and Eco31I to control the insertion of the two BbsI sites in p15.01.

Analytical digestion protocol Prepare the following mix: 2µL 10X Digestion buffer 0.5µL Eco31I 0.5µL BbsI 2µL of DNA (200ng) 15µL water incube 1h at 37°C

HERE IS THE PICTURE OF THE CORRESPONDING GEL

Both T2 and T3 transformants present the same bands as pKV6, whereas T1 shows 3 bands at 2.7kb, 1.7kb and 1.4kb.
We then sequenced the T1 transformants to have a confirmation of the gel results.
Oligos used for sequencing are o15.097(CGGTAGAGCTCCCTTCTATGC) and o15.098(CTGGCACGACAGGTTTCCC).
Overnight of T1 in LB+ery(150µG/mL).

Dialyse of both ligation products(p15.01 and p15.02) and both native plasmids (pKV6 and pSIP411) on 0.025µm cellulose filter for 20 minutes.

Transformation of DH5α by electroporation with the previously ligated p15.01 and p15.02.

Electroporation Protocol Thaw electrocompetent cells on ice Add 2µL of ligation product or 0.5µL of native plasmid to the cells Transfer the cells in an 0.2mm electroporation cuvette put the cuvette in the electroporation device and pulse the cells at 2.5kV, 200 Ohms and 25µF add 200µL of LB right after pulsing recover 2 hours at 37°C plate 200µL and 50µL of the cells on LB + erythromycin (200µg/mL), incubate overnight at 37°C

Cells were plated on two LB + erythromycin (200µg/mL) plates. The first was inoculated with 50µL, the second with µL.

25/07

Transformation results

Transformed product	pKV6	pSIP411	p15.01	p15.02	negative control
Growth Results	lawn of unrecognized bacteria with dense colonies	200µL: 11 single colonies 50µL: 7 single colonies	200µL: 32 single colonies 50µL: 0 colony	200µL: thin lawn of unrecognized bacteria with dense colonies 50µL: thin lawn of unrecognized bacteria	thin lawn of unrecognized bacteria

As the negative control showed a growth, we discarded these results and decided to perform a second transformation, with the same ligation products, using the same protocol. Time constants were 5.3 for all the pulses. pKV6 and p15.01 were plated on LB + erythromycin (200µg/mL); pSIP411 and p15.02 were plated on LB + erythromycin (150µg/mL) and LB + erythromycin (200µg/mL).

27/07

Transformation results

Transformed product	pKV6	pSIP411	p15.01	p15.02	negative control
Growth Results	158 single colonies	200µg/mL: thin lawn of unrecognized bacteria 150µg/mL: thin lawn of unrecognized bacteria	200µL: 32 single colonies 50µL: 0 colony	200µL: thin lawn of unrecognized bacteria with dense colonies 50µL: thin lawn of unrecognized bacteria	thin lawn of unrecognized bacteria