Difference between revisions of "Team:UNITN-Trento/Measurement"

m
m
Line 393: Line 393:
 
</div>
 
</div>
 
<div class="7u 12u(narrower)">
 
<div class="7u 12u(narrower)">
<p>The cells were thawed and resuspended in <span class="i_enph quantity">3 ml</span> of PBS. An aliquot of <span class="i_enph quantity">150 &mu;l</span> of each sample was placed into a white, flat-bottomed, 96-well Costar Plate (code: 3917) and fluorescence intensities were taken with a Tecan Infinite® 200 Pro Plate Reader (made in Switzerland). Excitation wavelength and emission wavelength were <span class="i_enph quantity">395 nm</span> and <span class="i_enph quantity">509 nm</span>, respectively. The gain was optimized at <span class="i_enph quantity">70 V</span> and kept constant for each sample. PBS was used as blank. To obtain technical replicates, fluorescence intensities were acquired for three aliquots of the same biological sample, keeping the same instrumental conditions. The raw data were adjusted for the blank value and the MEANS across the replicates with their relative standard deviation were plotted.</p>
+
<p>The cells were thawed and resuspended in <span class="i_enph quantity">3 ml</span> of PBS. An aliquot of <span class="i_enph quantity">150 &mu;l</span> of each sample was placed into a <b>White, Flat-bottomed, 96-well Costar Plate</b> (code: 3917) and fluorescence intensities were taken with a <b>Tecan Infinite® 200 Pro Plate Reader</b> (made in Switzerland). Excitation wavelength and emission wavelength were <span class="i_enph quantity">395 nm</span> and <span class="i_enph quantity">509 nm</span>, respectively. The gain was optimized at <span class="i_enph quantity">70 V</span> and kept constant for each sample. PBS was used as blank. To obtain technical replicates, fluorescence intensities were acquired for three aliquots of the same biological sample, keeping the same instrumental conditions. The raw data were adjusted for the blank value and the MEANS across the replicates with their relative standard deviation were plotted.</p>
 
</div>
 
</div>
 
</div>
 
</div>
Line 401: Line 401:
 
 
 
<div class="7u 12u(narrower)">
 
<div class="7u 12u(narrower)">
<p>The cells were thaw and resuspended in <span class="i_enph quantity">3 ml</span> of PBS. Each measurement was taken in a clear acrylic cuvette (REF 67.755) with a Cary Eclipse Fluorescence Spectrophotometer (made in USA). The blank was done with PBS. The excitation wavelenght used was <span class="i_enph quantity">395 nm</span> and the spectra were acquired between <span class="i_enph quantity">420 nm</span> to <span class="i_enph quantity">650 nm</span>. The gain was optimized at <span class="i_enph quantity">775 V</span> and kept the same throughout the measurement.</p>
+
<p>The cells were thaw and resuspended in <span class="i_enph quantity">3 ml</span> of PBS. Each measurement was taken in a clear acrylic cuvette (REF 67.755) with a <b>Cary Eclipse Fluorescence Spectrophotometer</b> (made in USA). The blank was done with PBS. The excitation wavelenght used was <span class="i_enph quantity">395 nm</span> and the spectra were acquired between <span class="i_enph quantity">420 nm</span> to <span class="i_enph quantity">650 nm</span>. The gain was optimized at <span class="i_enph quantity">775 V</span> and kept the same throughout the measurement.</p>
 
<p>The fluorescence intensity of the maximum emission wavelenght (<span class="i_enph quantity">514 nm</span>) was adjusted for the blank and the calculated means with relative standard deviations were plotted.</p>
 
<p>The fluorescence intensity of the maximum emission wavelenght (<span class="i_enph quantity">514 nm</span>) was adjusted for the blank and the calculated means with relative standard deviations were plotted.</p>
 
</div>
 
</div>
Line 415: Line 415:
 
 
 
 
<p>The cells were grown from glycerol stock until an OD<sub>600</sub> of <span class="i_enph quantity">0.7</span> was reached. Total  RNA was purified by using the Thermo Scientific GeneJET RNA Purification Kit, following the manufacturer`s instructions and subsequently genomic DNA was  removed from the total RNA by using the Thermo Scientific RapidOut DNA Removal Kit, following the manufacturer`s instructions. RNA levels were quantified using NanoDrop 1000 and reverse transcription of cDNA from the RNA template was  performed with Thermo Scientific RevertAid First Strand cDNA Synthesis Kit,  following the manufacturer`s instructions. qPCR reactions were performed with BioRad CFX96 TouchTM Real-Time PCR Detection System (made in USA) and  assembled as follows:</p>
+
<p>The cells were grown from glycerol stock until an OD<sub>600</sub> of <span class="i_enph quantity">0.7</span> was reached. Total  RNA was purified by using the <b>Thermo Scientific GeneJET RNA Purification Kit</b>, following the manufacturer`s instructions and subsequently genomic DNA was  removed from the total RNA by using the <b>Thermo Scientific RapidOut DNA Removal Kit</b>, following the manufacturer`s instructions. RNA levels were quantified using <b>NanoDrop 1000</b> and reverse transcription of cDNA from the RNA template was  performed with <b>Thermo Scientific RevertAid First Strand cDNA Synthesis Kit</b>,  following the manufacturer`s instructions. qPCR reactions were performed with <b>BioRad CFX96 TouchTM Real-Time PCR Detection System</b> (made in USA) and  assembled as follows:</p>
 
 
 
<div class="row">
 
<div class="row">
Line 511: Line 511:
 
<div style="display:none;">
 
<div style="display:none;">
 
 
<p>The cells were grown from glycerol stocks as described above. Differently from before when they reached the OD of <span class="i_enph quantity">0.7</span> were not frozen, but were used immediately to measure fluorescence intensity. An aliquot of <span class="i_enph quantity">5 &mu;l</span> of cells was diluted in <span class="i_enph quantity">900 &mu;l</span> of PBS. The instrument used was a BD FACSCanto (made in USA) set with the following parameters:</p>
+
<p>The cells were grown from glycerol stocks as described above. Differently from before when they reached the OD of <span class="i_enph quantity">0.7</span> were not frozen, but were used immediately to measure fluorescence intensity. An aliquot of <span class="i_enph quantity">5 &mu;l</span> of cells was diluted in <span class="i_enph quantity">900 &mu;l</span> of PBS. The instrument used was a <b>BD FACSCanto</b> (made in USA) set with the following parameters:</p>
 
<ul  class="customlist arrowed" style="margin-bottom:1em;">
 
<ul  class="customlist arrowed" style="margin-bottom:1em;">
 
<li>FSC gain: 525 V</li>
 
<li>FSC gain: 525 V</li>
Line 533: Line 533:
 
<i class="liticon wow bounceInLeft delay03 flaticon-test17"></i> <h4 class="header4 displayControl">Fluorescence readings: E. coli S30 Extract System for DNA Circular  </h4>
 
<i class="liticon wow bounceInLeft delay03 flaticon-test17"></i> <h4 class="header4 displayControl">Fluorescence readings: E. coli S30 Extract System for DNA Circular  </h4>
 
<div style="display:none;">
 
<div style="display:none;">
<p>Miniprepped DNA was purified and extracted through phenol/chloroform extraction followed by ethanol precipitation. Reactions were set following Promega E. coli S30Extract System Technical Bulletin and were performed using Qiagen Rotor-Gene Q (made in USA). Parameters for this specific experiment were set as follows:</p>
+
<p>Miniprepped DNA was purified and extracted through phenol/chloroform extraction followed by ethanol precipitation. Reactions were set following <b>Promega E. coli S30Extract System Technical Bulletin</b> and were performed using <b>Qiagen Rotor-Gene Q</b>(made in USA). Parameters for this specific experiment were set as follows:</p>
 
<ul class="customlist arrowed">
 
<ul class="customlist arrowed">
 
<li>Green channel gain: <span class="i_enph quantity">0.67</span></li>
 
<li>Green channel gain: <span class="i_enph quantity">0.67</span></li>

Revision as of 08:55, 31 August 2015

InterLab Measurement Study

What happens when GFP meets different promoters? Are they all the same? Here is what we found out!

  • Introduction & Achievements

  • Experimental Design

  • Experiments& Protocols

  • Final Discussion & Results

The Interlab Measurement Study

The characterization of standard parts has always been one of the main concerns in Synthetic Biology. For this very same reason, iGEM teams from all around the World were suggested to take part in the biggest measurement study ever conducted and the 2015 UNITN iGEM Team answered the call. The goal of this Second International Measurement Interlab Study is to assemble three different devices, each one containing a promoter with a screening plasmid intermediate and collect as many fluorescence data as possible. iGEM teams are free to use any technique to measure their devices as long the obtained data are solid and reproducible.

Clear Data and Protocols

We listed in the ”InterLab Study” page:

  • All devices measured for this study
  • All protocols developed and adopted
  • Sequencing data for all measurements devices

3 BioBrick devices

We used the three BioBrick devices listed in the ”Required Devices” section.

5 techniques

We used in-vivo and in-vitro techniques for measuring RNA and protein levels:

  • Plate Reader
  • Spectrofluorimeter
  • FACS
  • RT-qPCR
  • Cell-Free Extract

Statistical Reliability

We have three biological replicates for each measurement, with positive and negative controls

Worksheet and Protocol

We completed the InterLab Worksheet and the InterLab Protocol

Extra Credit Assignment

We did technical replicates for each sample

Experimental Design

We used the three mandatory devices for the measurement study:

The measurement devices were prepared by amplifying the reporter (BBa_I20270) by PCR. The amplified insert was then cut with XbaI and PstI and ligated into the plasmid containing the promoter previously cut with SpEI and PstI. All the devices were confirmed by restriction digestion as well as DNA sequencing.


In-vivo Measurements

The confirmed devices were then transformed in different bacterial strains of E. coli: NEB10β, NEB Express, and JM109. Each measurement was taken at the same optical density to allow a more precise comparison of the data. For each device we have 3 biological and 3 technical measurements for each used technique. We measured in vivo fluorescence emission in different ways using Tecan Infinite 200 PRO plate reader, Varian Cary Eclipse spectrofluorimeter, and BD FACSCanto FACS.


In-vitro Measurements

We also focused of transcription since the characterization is about promoters. To do so we performed RT-qPCR using a BioRad CFX96 Touch™ Real-Time PCR Detection System. Additionally, we performed an in vitro characterization study, by measuring the fluorescence intensities of each device with a Cell-Free E. coli S30 Extract System with a Qiagen Rotor-Gene Q.

Experiments & Protocols

Extraction from the Registry

All the parts needed for the InterLab Study were extracted from the 2015 iGEM Registry Distribution Kit.

Part ID Description Plasmid Backbone 2015 Registry Location
BBa_K823005 Anderson promoter J23101 pSB1C3 Plate 1; 20K
BBa_K823008 Anderson promoter J23106 pSB1C3 Plate 1; 22A
BBa_K823013 Anderson promoter J23117 pSB1C3 Plate 1; 22K
BBa_I12504 RBS + GFP + 2 terminators pSB1A2 Plate 4; 21J
BBa_R0040 TetR sequence pSB1C3 Plate 2; 6F
BBa_I20270 Promoter MeasKit pSB1C3 Plate 3; 8P

Polymerase Chain Reaction (PCR)

Restriction Digestion of plasmids containing the promoter

Each promoter containing plasmid was digested with 1 μl of SpeI and 1 μl of PstI at 37°C overnight. The day after add 1 μl of phosphatase (CIP from New England Biolabs) for 2 hours at 37°C. The enzymes were then heat deactivated.

The digestion reactions were assembled in this way:

PCR Products Plasmids
Template 3000 ng 2000 ng
Enzyme 1 2 μl 1.5 μl
Enzyme 2 2 μl 1.5 μl
Buffer (Stock 10X) 5 μl 5 μl
BSA (Stock 10X) 5 μl 5 μl
Water Up to 50 μl Up to 50 μl

Ligation

Plasmid: Insert = 1 : 3 Control
Vector 100 ng 100 ng
Insert 125 ng -
10X Buffer 2 μl 2 μl
Buffer (Stock 10X) 5 μl 5 μl
T4 - DNA Ligase 2 μl 2 μl
Water Up to 20 μl Up to 20 μl

The ligation reactions were assembled and incubated at room temperature for 1 hour according to the table beside. Subsequently 10 μl of the ligation mixture were transformed and plated into LB-agar plates with the proper antibiotic resistance. The confirmed devices were transfected in NEB10β, JM109, NEB Express.

Parts Confirmation

Correct clones were screened by restriction digestion and confirmed by sequencing:

Glycerol stocks preparation and Sample Growth

A single colony was inoculated with a sterile pipette tip in a test tube with 10 ml of LB and antibiotic (1000:1 LB to antibiotic ratio) and placed in the thermoshaker (190 rpm, 37°C. When the culture got cloudy, 40 ml of LB+antibiotic were added to reach a final volume of 50 ml. The cells were grown until an OD600 of 0.5 and then centrifuged at 4100 rpm for 10 minutes at 4 °C. The supernatant was discarded and the cells were resuspend in 5 ml of LB + antibiotic + glycerol (20% v/v). The cells were kept on ice and were promptly aliquoted into 200 μl tubes and frozen at -80°C immediately. From this protocol we obtained a 10X concentrated glycerol stock for each sample.

The glycerol stock was thaw and added into 10 ml of LB with antibiotic, giving a starting culture with an OD600 of 0.1. The sample were grown in a 50 mL conical plastic tube in the termoshaker at 37°C and were grown until an OD600 0.7. At this point 3 ml of the culture were transferred in a new tube, centrifuged it, and stored at -20°C, except if otherwise indicated.

Fluorescence readings: Tecan INFINITE ® 200 PRO Plate Reader

Fluorescence readings: Cary Eclipse Fluorescence Spectrophotometer

Fluorescence readings: BioRad CFX96 TouchTM Real-Time PCR Detection System

The cells were grown from glycerol stock until an OD600 of 0.7 was reached. Total RNA was purified by using the Thermo Scientific GeneJET RNA Purification Kit, following the manufacturer`s instructions and subsequently genomic DNA was removed from the total RNA by using the Thermo Scientific RapidOut DNA Removal Kit, following the manufacturer`s instructions. RNA levels were quantified using NanoDrop 1000 and reverse transcription of cDNA from the RNA template was performed with Thermo Scientific RevertAid First Strand cDNA Synthesis Kit, following the manufacturer`s instructions. qPCR reactions were performed with BioRad CFX96 TouchTM Real-Time PCR Detection System (made in USA) and assembled as follows:

cDNA 5 ng
Primer Fw 180 ng
Primer Rv 180 ng
BioRad iQ™ SYBR® Green Supermix #1708880 Up to 10 μl
GFP Primer Fw ATGCTTTGCGAGATACCCAG
GFP Primer Rv TGTCTTGTAGTTCCCGTCATC
idnT Primer Fw CTGCCGTTGCGCTGTTTATT
idnT Primer Rv GATTTGCTCGATGGTGCGTC

Primers were designed for the reporter gene GFP_mut3b and for the housekeeping gene idnT (D-gluconate transporter) as indicated above.

We then analyzed the raw data, calculating the relative fold expression of each GPF device compared to the housekeeping (ΔCt) and the related standard deviation:

Device Relative Fold Expression (A.U.) Standard Deviation
J23101 67,421.53 16,016.27
J23106 18,506.44 3,146.38
J23117 658.08 79.09
R0040 0.04 0.02
I20270 17,800.56 1,030.40

Fluorescence readings: BD FACSCanto

The cells were grown from glycerol stocks as described above. Differently from before when they reached the OD of 0.7 were not frozen, but were used immediately to measure fluorescence intensity. An aliquot of 5 μl of cells was diluted in 900 μl of PBS. The instrument used was a BD FACSCanto (made in USA) set with the following parameters:

  • FSC gain: 525 V
  • SSC gain: 403 V
  • FITC gain: 510 V
  • Flow rate: LOW
  • Total number of events in P2: 10000

Those parameters allowed the instrument to process 900/1500 events per second. We analyzed the raw data and plot the means of three replicates with relative standard deviations.

Fluorescence readings: E. coli S30 Extract System for DNA Circular

Miniprepped DNA was purified and extracted through phenol/chloroform extraction followed by ethanol precipitation. Reactions were set following Promega E. coli S30Extract System Technical Bulletin and were performed using Qiagen Rotor-Gene Q(made in USA). Parameters for this specific experiment were set as follows:

  • Green channel gain: 0.67
  • Green channel Excitation: 365±20 nm
  • Green channel Emission: 510±5 nm

We analyzed the raw data and plot the means of three replicates over time:

Final Discussion

Our characterization confirmed the relative strength of the promoters

J23101 is the strongest promoter among the three, showing high expression of GFP in all three strains, regardless of the technique used. J23106 is the medium promoter and J23117 the weakest.

Ratios across promoters are kept the same

J23101/J23106 fluorescence ratios ranged from 2.0 to 4.5, depending on the strain and the technique. Differently from the other two promoters, J23117 showed a very low GFP production, as it was not detectable by eye or using the trans-illuminator and showed little fluorescence with the three techniques used.

Different techniques lead to the same results, with different sensitivities

The best way to perform a characterization is to use various techniques. Throughout our experiments we saw that each instrument has a specific sensitivity, which alters the output data. The FACS happened to be the most accurate among all, due to its extremely high intrinsic sentivity. The plate reader also showed a good accuracy while the fluorimeter was not able to detect the weakest promoter from the background noise, due to its low intrinsic sensitivity.

Bacterial strain does matter

The three promoters behaved differently in the different bacterial strains used. The bacterial strain which gave the highest fluorescence was NEB10Beta cells in all cases showed a significant increased expression of the protein, compared to JM109 and NEB Express. We hypothesized this discordance among strains is due to their different genotypes. A different bacterial proteome (i.e. presence/lack of specific proteases and/or chaperonins, polymerases efficiency) may alter protein production, processing and folding, thus fluorescence emission.

In vitro conditions mimic the in vivo reality

Characterization in vitro using techniques like the cell-free extract and the qPCR allows to quantify the promoter strength by measuring transcript level, rather than just looking at the protein production. This approach gives a better understanding on the promoter`s nature, since it`s well known that the central dogma in biology is not always respected.