Difference between revisions of "Team:EPF Lausanne/Notebook/Ecoli"
Line 282: | Line 282: | ||
<p>sgRNA cassette Z0 was amplified with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).</br>sgRNA cassette Z4 was amplified with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).</br>sgRNA cassette Z35 was successfuly amplified with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)</br>sgRNA cassette X0 was successfuly amplified with Phusion PCR. (cf. Fig.10d)</br>sgRNA cassette X4 was successfuly amplified with Phusion PCR. (cf. Fig.10e)</br>sgRNA cassette X35 was successfuly amplified with Phusion PCR. (cf. Fig.10f)</p> | <p>sgRNA cassette Z0 was amplified with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).</br>sgRNA cassette Z4 was amplified with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).</br>sgRNA cassette Z35 was successfuly amplified with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)</br>sgRNA cassette X0 was successfuly amplified with Phusion PCR. (cf. Fig.10d)</br>sgRNA cassette X4 was successfuly amplified with Phusion PCR. (cf. Fig.10e)</br>sgRNA cassette X35 was successfuly amplified with Phusion PCR. (cf. Fig.10f)</p> | ||
<div class="row"> | <div class="row"> | ||
− | <a href="https://static.igem.org/mediawiki/2015/3/3b/Lab_nb_ecoli_fig10a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/3b/Lab_nb_ecoli_fig10a.jpg" alt="Figure 10a" style="height: | + | <a href="https://static.igem.org/mediawiki/2015/3/3b/Lab_nb_ecoli_fig10a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/3b/Lab_nb_ecoli_fig10a.jpg" alt="Figure 10a" style="height:140px"></a> |
− | <a href="https://static.igem.org/mediawiki/2015/8/80/Lab_nb_ecoli_fig10b.jpg"><img src="https://static.igem.org/mediawiki/2015/8/80/Lab_nb_ecoli_fig10b.jpg" alt="Figure 10b" style="height: | + | <a href="https://static.igem.org/mediawiki/2015/8/80/Lab_nb_ecoli_fig10b.jpg"><img src="https://static.igem.org/mediawiki/2015/8/80/Lab_nb_ecoli_fig10b.jpg" alt="Figure 10b" style="height:140px"></a> |
− | <a href="https://static.igem.org/mediawiki/2015/9/94/Lab_nb_ecoli_fig10c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/94/Lab_nb_ecoli_fig10c.jpg" alt="Figure 10c" style="height: | + | <a href="https://static.igem.org/mediawiki/2015/9/94/Lab_nb_ecoli_fig10c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/94/Lab_nb_ecoli_fig10c.jpg" alt="Figure 10c" style="height:140px"></a> |
− | <a href="https://static.igem.org/mediawiki/2015/5/57/Lab_nb_ecoli_fig10d.jpg"><img src="https://static.igem.org/mediawiki/2015/5/57/Lab_nb_ecoli_fig10d.jpg" alt="Figure 10d" style="height: | + | <a href="https://static.igem.org/mediawiki/2015/5/57/Lab_nb_ecoli_fig10d.jpg"><img src="https://static.igem.org/mediawiki/2015/5/57/Lab_nb_ecoli_fig10d.jpg" alt="Figure 10d" style="height:140px"></a> |
− | <a href="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg" alt="Figure 10e" style="height: | + | <a href="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg" alt="Figure 10e" style="height:140px"></a> |
− | <a href="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg"><img src="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg" alt="Figure 10f" style="height: | + | <a href="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg"><img src="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg" alt="Figure 10f" style="height:140px"></a> |
</div> | </div> | ||
<p><b>Fig.10: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</small></p> | <p><b>Fig.10: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</small></p> |
Revision as of 09:49, 11 September 2015
Construction of pdCas9-wMay 7th to June 1st 2015
pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP.
Materials and method
- Open pdCas9-bacteria by Phusion PCR (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler ladder)pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).
- Extract w subunit from pWJ66 by Phusion PCR (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
- Gibson assembly (cf. Protocols) of pdCas9-w using purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + restriction digest (Cf. Protocols) of pdCas9-w (isolated by Miniprep (cf.Protocols)) with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products (with 1kb Generuler) + sequencing (Microsynth)
- Site-directed mutagenesis (cf. Protocols) of dCas9-w with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w (necesary for pdCas9-w to be BioBrick compatible)Control with restriction digest (cf. Protocols) of mutated pdCas9-w (isolated by Miniprep (cf. Protocols)) with EcoRI + sequencing (Microsynth)
- BioBrick mutated dCas9-w
Results
Open pdCas9 by PCRMay 10th 2015
Linearized pdCas9-w is expected to be 6705 bp.We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. Many, but not all, of our samples were successfully amplified (cf. Fig.1).For next steps, sample from lane 1 (cf. Fig.1) was used.
Extract w subunit from pWJ66 by PCRMay 7th 2015
Gibson assembly of pdCas9-wMay 29th and June 1st 2015
Colony PCR - 05/29/2015
Amplicons are 666 bp if Gibson assembly worked and 396 bp if the plasmid self-ligated.Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.Gibson assembly seems to have worked for some samples. (cf. Fig.3)To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.
Restriction digest - 06/01/2015
pdCas9-w samples from different colonies are present on gels in triplicates in the following order:
- Undigested - expected to yield 7 kb circular plasmid (migrates faster than linear fragments of the same size)
- Digested by BamHI - expected to yield two fragments of 6147 bp and 834 bp if insert is present or one 6705 bp fragment if it is not
- Digested by KpnI - expected to yield two fragments of 45334 bp and 2447 bp if insert is present or one 6705 bp fragment if it is not
BamHI and KpnI are both unique cutters in pdCas9 (without the insert) and double cutters in pdCas9-w (with the insert).Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see.By looking at the relative heights, we can say that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel. Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).
Sequencing - (date?)
As dCas9-w is very long, only part of it was sequenced (the w subunit and its surrounding base pairs). No mutations were detected.
Site-directed mutagenesis of dCas9-w - (date?)
BioBrick mutated dCas9-w - (date?)
Construction of pdCas9-w-sgRNAs - July 9th to August 7th 2015
These experiments consist of inserting one or two sgRNA producing cassettes (cf. Fig.8a) into pdCas9-w. In part 1, one sgRNA (X0, X4, X35, Z0, Z4 or Z35) was inserted into pdCas9-w by Gibson assembly. For technical reasons, we were unable to make most constructs with two inserted cassettes using this method. In part 2, we extracted sgRNA cassettes from existing constructs and inserted them in other constructs that already contained one other sgRNA cassette.
Materials and method
Part 1: Assemble pdCas9-w + sgRNA
- Open pdCas9-w by restriction digest (cf. Protocols) with BsrBI (blunt ends) + agarose gel electrophoresis of 2 µL of digested and undigested product (with 1kb Generuler)
- Amplify sgRNA cassettes by Phusion or Q5 PCR (cf. Protocols) with primers f_Gbs_sgRNA-A and r_Gbs_sgRNA-B + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols).
- Gibson assembly pdCas9-w-sgRNA (cf. Protocols) with linearized pdCas9-w and purified sgRNA PCR products + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)Control with colony PCR (cf. Protocols) with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) (one colony PCR (cf. Fig11a) was done with primers f_Gbs_pdCas9 and r_Scq_pdCas9_w_sgRNA) + sequencing (Microsynth)
Part 2: Assemble pdCas9-w-sgRNA + sgRNA
- Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers f_Gbs_sgRNAinPd and r_Gbs_sgRNAinPd + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols)
- Open pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers f_opn_d9w and r_opn_d9w + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols)
- Gibson assembly of pdCas9-w-sgRNA, as describes in table below, + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)Control with colony PCR (cf. Protocols) with primers f_Sq_CoP_pdCas92ndIns and r_Sq_CoP_pAraC2ndInsert + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) + sequencing (Microsynth)
sgRNA insert | sgRNA in pdCas9-w-sgRNA (backbone) |
---|---|
Z4 | pdCas9-w-Z0 |
Z35 | pdCas9-w-Z0 |
Z35 | pdCas9-w-Z4 |
X4 | pdCas9-w-X0 |
X35 | pdCas9-w-X0 |
X35 | pdCas9-w-X4 |
Results
Part 1: Assemble pdCas9-w + sgRNA
Open pdCas9-w by restriction digestJuly 16th, 19th and 26th 2015 (repeats)
The digested and undigested plasmids have the same size. Circular fragments migrates faster than linear fragments of the same size. This means that the undigested plasmid will migrate faster than the digested plasmid.Even though the ladder is not clear, by looking at the relative heights we can see that the digested sample migrated more slowly than the undigested sample (cf. Fig.9). The restriction digest was successful.
Amplify sgRNA cassettes by PCRJuly 9th, 10th, 13th, 14th, 16th and August 4th 2015
Amplified sgRNA cassettes are expected to be about 370 bp.
sgRNA cassette Z0 was amplified with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).sgRNA cassette Z4 was amplified with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).sgRNA cassette Z35 was successfuly amplified with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)sgRNA cassette X0 was successfuly amplified with Phusion PCR. (cf. Fig.10d)sgRNA cassette X4 was successfuly amplified with Phusion PCR. (cf. Fig.10e)sgRNA cassette X35 was successfuly amplified with Phusion PCR. (cf. Fig.10f)
Fig.10: Gels of sgRNA cassettes amplified by PCRFig.10a - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)Fig.10b - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BFig.10c - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BFig.10d - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BFig.10e - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BFig.10f - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B
Assemble pdCas9-w-sgRNA constructs - July 26th, 29th and August 7th 2015
In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.
pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.11a) was confirmed by sequencing to be pdCas9-w-Z0 and to not contain any mutations that may have an effect on its activity. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.11a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. (This sample will be used again in Part 2.)Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.11b). Sequencing comfirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.11c) and sequencing confirmed that is the case. Sequencing also showed some mutations or deletions in the promoter and/or terminator for these 2 samples. We decided to keep working with these and test whether these mutations are significative with an activity assay.Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.11d). However, it contains a mutation in the promoter. A 2nd pdCas9-w-X0 without mutations will be constructed in part 2, after which we will be able to compare the activity of this promoter with/without a mutation.Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.11e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4 and that it does not contain any mutations.Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.11d) and no mutations were found in the sequence.
![Figure 11a](https://static.igem.org/mediawiki/2015/f/f8/Lab_nb_ecoli_fig11a.jpg)
![Figure 11b](https://static.igem.org/mediawiki/2015/c/c4/Lab_nb_ecoli_fig11b.jpg)
![Figure 11c](https://static.igem.org/mediawiki/2015/e/e0/Lab_nb_ecoli_fig11c.jpg)
![Figure 11d](https://static.igem.org/mediawiki/2015/archive/6/64/20150902094918%21Lab_nb_ecoli_fig11d.jpg)
![Figure 11e](https://static.igem.org/mediawiki/2015/a/ae/Lab_nb_ecoli_fig11e.jpg)
Part 2: Assemble pdCas9-w-sgRNA + sgRNA
Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR
Amplified sgRNA cassettes (Z4, Z35, X4 and X35) are expected to be 400 bp. All were successfully amplified (cf. Fig.12a and Fig.12b).Amplified pdCas9-w-sgRNA (Z0, Z4, X0 and X4) are expected to be about 7000 bp. All were successfully amplified (cf. Fig.12a and Fig.12b).
Assemble pdCas9-w-sgRNA-sgRNA constructs
Colony PCR primers are placed such as amplicons are ?? bp if Gibson assembly worked and are ?? bp if it did not.
![Figure 12a](https://static.igem.org/mediawiki/2015/e/eb/Lab_nb_ecoli_fig12a.jpg)
![Figure 12b](https://static.igem.org/mediawiki/2015/e/e5/Lab_nb_ecoli_fig12b.jpg)
Construction of pWJ89alt
pWJ89alt contains GFP controlled by the promoter J23117alt, which can be activated by dCas9-w bound to sgRNA X4 and inhibited by dCas9-w bound to sgRNA X0 or X35.
Materials and method
- Phusion and Q5 PCR (cf. Protocols) pWJ89 wihtout its J23117 promoter with primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89 + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols). pWJ89 was a gift from David Bikard.
- Phusion and Q5 PCR J23117alt promoter with primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols). J23117alt was synthesized by IDT.
- Gibson assembly of pWJ89alt with purified PCR products pWJ89 (without J23117) and J23117alt promoter + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)Control with colony PCR (cf. Protocols) with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) + sequencing (Microsynth)
- BioBrick J23117alt promoter
Results
PCR pWJ89
Successful PCR reactions are expected to yield 4400 bp amplicons.Both negative control lanes (cf. Fig.13) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.13). We will work with this sample for next steps.
PCR J23117alt promoter
Successful PCR reactions are expected to yield 340 bp amplicons.Both negative control lanes (cf. Fig.14) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.
Gibson assembly of pWJ89alt
Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).
BioBrick J23117alt promoter
Construction of pWJ89alt_Z4-to-X4
pWJ89alt_Z4-to-X4 contains a cassette producing sgRNA X4 (activator for J23117alt) controlled by the promoter J23117 and GFP under the J23117alt promoter (corresponds to pWJ89alt).
Materials and method
- Open pWJ89alt by restriction digest by AfeI + Agarose gel electrophoresis of 2 µL of digested product (with 1kb Generuler)
- PCR Z4-to-X4
- Gibson assembly of pWJ89alt_Z4-to-X4 with linearized pWJ89alt and purified PCR product of Z4-to-X4 + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)Control with colony PCR (cf. Protocols) (primers?) + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) + sequencing (Microsynth)
Open pWJ89alt by restriction digest
PCR Z4-to-X4
Gibson assembly pWJ89alt_Z4-to-X4
Construction of pWJ89_mCherry
Open pWJ89 by restriction digest
PCR pWJ89alt
Extract mCherry by restriction digest
PCR mCherry
Gibson assembly of pWJ89_mCherry
Transistor activity assay
Primer table
Name | Sequence | Associated part |
---|---|---|
f_Gbs_pdCas9 | CTCGAGTAAGGATCTCCAG | pdCas9 |
f_Gbs_sgRNA-CtoA | GTCGGCGATGGTGGTAGCTAATTATGTTCCctcgctcactgactcgctac | sgRNA cassettes |
f_Gbs_sgRNA-DtoA | CTAGACCTAACTGAGATACTGTCATAGACGctcgctcactgactcgctac | sgRNA cassettes |
f_Gbs_sgRNA-A | ctcgctcactgactcgctac | sgRNA cassettes | f_Gbs_w | ACACGCATTGATTTGAGTCA | pWJ66 |
f_Mt_A2080C_pdCas9-w | TGACTTTTCGcATTCCTTATTATGTTG | pdCas9-w |
r_Gbs_pdCas9 | GTCACCTCCTAGCTGACTC | pdCas9 |
r_Gbs_sgRNA-B | tggcatcttccaggaaatc | sgRNA cassettes/td> |
r_Gbs_sgRNA-BtoC | GGAACATAATTAGCTACCACCATCGCCGACtggcatcttccaggaaatc | sgRNA cassettes |
r_Gbs_sgRNA-BtoD | CGTCTATGACAGTATCTCAGTTAGGTCTAGtggcatcttccaggaaatc | sgRNA cassettes/td> |
r_Gbs_w | atttgatgcctggagatccttactcgagTTAACGACGACCTTCAGCA | pWJ66 |
r_Mt_A2080C_pdCas9-w | AGATTTTTTCAATCTTCTCACG | pdCas9-w |
r_Scq_pdCas9_w_sgRNA | ctgatttgagcgtcagat | pdCas9-w-sgRNA |