Difference between revisions of "Team:USTC/Notebook"

Medium preparation

Prepare and keep a part of solid medium and broth in the refrigerator as a backup.

Cell culture

Culture the cell,TOP10, with LB liquid solution overnight.

Design protocol

1. Take the solid medium, heat it until liquid. Then make two plate of solid medium, evenly. Cool it to the room temperature.
2. prepare antibiotic solution with concentration gradient
   a. prepare antibiotic(neomycin) solution with ddH2O at 50mg/ml as mother solution 1. And dilute it to 10% concertration(5mg/ml) with ddH2O as mother solution 2. Then prepare 8 parts of solution as this:

Number	Solution 1(V/uL)	Solution 2(V/uL)
0	0	0
1	0	0.2
2	0	1
3	0.2	0
4	0.4	0
5	0.6	0
6	0.8	0
7	1	0

Keep them in the 70℃ water bath. Then add 800uL liquid solid medium into each Ep tubes. Transfer them into 50℃ water bath.

1. Cut 4 hole in each plate of solid medium, whose diameter is at 8mm.
2. Take 5mL culture into the 2 Ep tubes. Centrifuge it at twice. Then add liquid solid medium at 50℃, each 800uL, dissolve evenly.
3. Take 200uL top10 solution into 8 Ep tubes each at 50℃. Then add the mixed solution into the hole at once until the hole is added up.

Results: the raw results showed differerent characteristics of chemotaxis based on distinct antibiotic concentration.

Analysis: 其中3号有最明显的趋化结果，说明这个趋化结果并不是完全正相关或负相关的。但是结论可能是存疑的，过量的加入固体培养基会导致可能的菌液溢出从而形成如此的趋化形状。因此实验配方需要进行更改。

4th Colonial PCR for COMPX

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl COMPX-F Primer
• 1μl COMPX-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl TOP10 Solution
• 12.35μl ddH2O

Renaturation at 55℃, extend for 1 min. 2 tubes without Taq DNA Polymerase as blank control.

4th Electrophoresis for Colonical PCR

Bands are predicted except one. Maybe caused by accident. PCR product keeped for later use.

1st Plasmid Extraction for BBa K1492002 & pSB1C3

1 Centifuge 5 ml bacterium solution, few sediment getted.

2 Add 250 μl Buffer P1, resuspend cells.

3 Add 250 μl Buffer P2, mix well, 4 min's standing.

4 Add 350 μl Buffer P3, mix well.

5 13.4 rpm centifuge 10 min, move all supernatant to adsorption column, 11.6 rpm centifuge 30 s, discard filtrate.

6 Add 500 μl Wash Solution, 11.6 rpm centifuge 30 s, discard filtrate. Repeat once.

7 11.6 rpm centifuge 1 min.

8 Add 50 μl ddH2O, 2 min's standing, 11.6 rpm centifuge 1 min.

1st Electrophoresis for Plasmid Extraction

No result. May due to high concentration of chloramphenicol, bacteria grow very slow. As there is few bacteria, no plasmid getted. Bacterium solution dilute 1:1 with LB medium.

The steak-plate of Pseudomonas aeruginosa

By using the steak-plate method, we successful separated the single conlony of P. aeruginosa.

\(^o^)/~！

2nd Plasmid Extraction for BBa K1492002 & pSB1C3

1. Centifuge 4.5 ml bacterium solution.
2. Add 250 μl Buffer P1, resuspend cells.
3. Add 250 μl Buffer P2, mix well, 4 min's standing.
4. Add 350 μl Buffer P3, mix well.
5. 13.4 rpm centifuge 10 min, move all supernatant to adsorption column, 11.6 rpm centifuge 30 s, discard filtrate.
6. Add 500 μl Wash Solution, 11.6 rpm centifuge 30 s, discard filtrate. Repeat once.
7. 11.6 rpm centifuge 1 min.
8. Add 30 μl ddH2O, 2 min's standing, 11.6 rpm centifuge 1 min.

2nd Electrophoresis for Plasmid Extraction

Successfully extracted tRNA plasmid. Failed to extract pSB1C3 plasmid, cause culture is contaminated.

Result:

tRNA 114ng/μl

1st PCR for tRNA

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl tRNA-F2 Primer
• 1μl tRNA-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl tRNA plasmid
• 12.35μl ddH2O

Renaturation at 50℃, extend for 1:30.

1st Electrophoresis for tRNA PCR

No result.

Transformation of Four Parts of Plate 4

material:
• competent cell TG1 from the lab 319
• 4 parts of the plate 4(pSB1A2)
• No.1:BBa_B0034 No.2:BBa_C0051
• No.3:BBa_R0051 No.4:BBa_E0040

the procedure
1. Take the competent bacteria from refrigerator and incubate them into ice about 10 mins until it is dissolved
2. Absorb 1 uL or 2 uL plasmid and mix it with bacteria solution thoroughly.
3. Put the tubes on the ice about 30 mins.
4. Make a heat shock at 42 degree centigrade about 60 sec
5. Put the tubes on the ice about 3 mins again.
6. Add 900 ul LB medium into EP tubes and cultivate the bacteria at 37 degree centrigrade about 60 min.
7. Centrifuge them at 4,000xg about 15 sec and we will se sediment in the tubes.
8. Discard the supernatant liquid and leave about 100ul medium.
9. Coat plate: add 100ul solution in a plate

The Results of Transformation of Jul 13th

transformations of three parts are successful:

• No.1 B0034
• No.2 C0051
• No.4 E0040

transformation of one part is failing:

No.3 R0051

Plasmid Extraction of pSB1C3

the plasmis:pSB1C3

the procedure:

1. Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 1 min and centrifuge about 1 min at 12,000xg.

PS:this protocol is from lab 319

the concentration :11.0ng/ul

PS:the concentration of the control plasmid is 136.0 ng/ul,so we guess that maybe the concentration of bacterium solution is low.Also we guess that it's caused by the missing of spreading.

Transformation of Three Parts and One Plasmid

the plasmid going to be transformed:
1. No.1 BBa_R0062(plate 2;pSB1C3)
2. No.2 BBa_B0015(plate 3;pSB1C3)
3. No.3 BBa_R0051(plate 4;pSB1A2)
4. No.4 pSB1C3

the procedure:

note:add 1 ul R0062 ,1 ul B0015,2 ul R0051,

2 ul pSB1C3 to 100 ul competent cells respectively

1. Take the competent bacteria from refrigerator and incubate them into ice about 10 mins until it is dissolved
2. Absorb 1 uL or 2 uL plasmid and mix it with bacteria solution thoroughly.
3. Put the tubes on the ice about 30 mins.
4. Make a heat shock at 42 degree centigrade about 60 sec
5. Put the tubes on the ice about 3 mins again.
6. Add 900 ul LB medium into EP tubes and cultivate the bacteria at 37 degree centrigrade about 60 min.
7. Centrifuge them at 4,000xg about 15 sec and we will se sediment in the tubes.
8. Discard the supernatant liquid and leave about 100ul medium.
9. Coat plate: add 100ul solution in a plate

Plasmid Extraction of Three Parts of Plate 4

the procedure is the same as before

the concentration :

B0034 157.6ng/ul, 113.7ng/ul;

C0051 171.7ng/ul, 194.6ng/ul;

E0040 278.5ng/ul, 228.2ng/ul

Results of transformation

R0051 no colony

R0062 have single colony

B0015 have single colony

pSB1C3 have single colony and the colony is red

Plasmid Extraction Results

This is extraction was for previous transformation.

• pSB1C3(1): 108ng/uL
• pSB1C3(2): 157ng/uL
• B0015(1): 19ng/uL
• B0015(2): 93ng/uL

Prepared for further use.

Colonical PCR for micF and SoxS

Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
micF-luxI-R	TTATAGTCATATAAATTTTCTCCTCTTTCCGAATGCGAGGCATCC
micF-F	GCGGCCGCTTCTAGAGCCTCATTAATCAGTCGGC
SoxS-RBS-luxI-R	TATAGTCATATAAATTTTCTCCTCTTTCTAGTGCGTGCGCCGGTACCTT
BB-SoxS-F	CGGCCGCTTCTAGAGCGTGCGGAACATTCG

For micF, primers including micF-luxI-R, micF-F, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl micF-luxI-R Primer
• 1μl micF-F Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl Top10(K-12) Strain E. coli bacterial solution
• 12.35μl ddH2O

For SoxS, primers including SoxS-RBS-luxI-R, BB-SoxS-F, protocol illustrates as:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl SoxS-RBS-luxI-R Primer
• 1μl BB-SoxS-F Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl 1μl Top10(K-12) Strain E. coli bacterial solution
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Characterization of Colonical PCR by Gel Electrophoresis

The result illustrated the success of PCR

Colonical PCR for OprF from Psudomonus aeruginosa

Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
OprF-F	AGAGGAGAAAATCGGAATGAAACTGAAGAACAC
OprF+Ter-R	TGATGCCTGGCTCTAGTATTACTTGGCTTCAGCTT

PCR protocol:

For OprF, primers including OprF-F, OprF+Ter-R, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl OprF-F Primer
• 1μl OprF+Ter-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl Psudomonus aeruginosa (PAO1) bacterial solution
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Plasmid Extraction of SCVE

SCVE synthesized from Sangon Biotech Co.,Ltd.

Procedure including:

1. Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 1 min and centrifuge about 1 min at 12,000xg.

Characterization of SCVE and OprF by Gel Electrophoresis

Only 1/4 PCR results successfully duplicated results, plasimid extraction from SCVE showed well.

Second PCR for OprF didn't work well:(

Digestion of E0040(EGFP)

Enzyme from Thermo Scientific FastDigest Enzyme with Green Buffer

Protocol as following:

• Nuclease-free water: 15ul
• E0040: 1ul
• 10* FastDigest Green Buffer: 2ul
• EcoRI: 1ul
• SpeI: 1ul

We are trying to figure out the best conditions of our experiment and whether we need loading buffer

Time	With Loading Buffer or not
5min	Yes(1), No(2)
2h	Yes(3), No(4)

PCR of E0040(EGFP)

Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
E0040-F	ATGCGTAAAGGAGAAGAACTTT
R0051-E0040-R	TACGCATATAAATTTTCTCCTCTTTGCAACCA

For E0040, primers including E0040-F, R0051-E0040-R, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl E0040-F Primer
• 1μl R0051-E0040-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl plasmid(pSB1C3) containing E0040
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Attention: R0051-E0040-R Primer is not appropriate because of only 8 complementary base pairs.

Characterization of E0040 from Digestion and PCR

Result illustrated that We do need loading buffer, and 5 min do work!

PCR showed more concentration of E0040!

Gel Extraction

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Final OD results:

Code	OD(ng/ul)
PCR(1)	15.3
PCR(2)	4.5
PCR(3)	27.0
Digestion(1) with 5 mins	15.4
Digestion(3) with 2 h	22.7

Perseved for further use.

Transfofmation of Three Parts

Protocol as following

• 100μl (three tubes)competent cells
• C0062(pSB1C3)
• R0010(pSB1C3)
• C0061(pSB1C3)
• LB without antibiotic
• LB medium with Amp/CmR

Plasmid Extraction of E0040

Procedure including:

1.Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.

2.Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.

3.Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.

4.Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.

5.Centrifuge tubes at 12,000xg about 10 mins.

6.Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.

7.Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.

8.Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.

9.Do the step 8 again.

10.Centrifuge the empty columns at 12,000xg about 1 min.

11.Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

Results

Code	OD(ng/ul)
E0040(1)	166.7
E0040(2)	169.2

Colonical PCR for OprF from Psudomonus aeruginosa

PCR protocol:

For OprF, primers including OprF-F, OprF+Ter-R, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl OprF-F Primer
• 1μl OprF+Ter-R Primer
• 0.5μl Taq DNA Polymerase(add more 0.25ul then previous protocol)
• 2μl MgCl2
• 1μl Psudomonus aeruginosa (PAO1) bacterial solution
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Digestion of E0040(EGFP)

Enzyme from Thermo Scientific FastDigest Enzyme with Green Buffer

Protocol as following:

• Nuclease-free water: 15ul
• E0040: 1ul
• 10* FastDigest Green Buffer: 2ul
• EcoRI: 1ul
• SpeI: 1ul

Characterization of OprF and E0040

酶连效果不是很好，基本建议是改善昨日胶回收的条带进行PCR扩增，之前引物设计担心不是很好，但是看样子没有其他位点被p了出来；

OprF的PCR依然是在相同条件下只有一个条带p了出来，比较异常；此外引物二聚体较多，因此对此批进行了胶回收，以备后续使用。

Plasmid Extraction of Cas9(K1218011)

The bacteria were cultured at 9 am from successfully transformed bacteria.

Procedure including:

1.Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.

2.Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.

3.Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.

4.Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.

5.Centrifuge tubes at 12,000xg about 10 mins.

6.Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.

7.Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.

8.Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.

9.Do the step 8 again.

10.Centrifuge the empty columns at 12,000xg about 1 min.

11.Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

Characterization of Cas9

转化成功，明天写实验结果讨论

Digestion of K1218011(Cas9)

Enzyme from Thermo Scientific FastDigest Enzyme with Green Buffer

Protocol as following:

• Nuclease-free water: 15ul
• K1218011: 1ul
• 10* FastDigest Green Buffer: 2ul
• EcoRI: 1ul
• SpeI: 1ul

Incubate into 37 degree celcius, 2h

Digestion of SCVE

Enzyme from Thermo Scientific FastDigest Enzyme with Green Buffer

Protocol as following:

• Nuclease-free water: 16ul
• SCVE: 1ul
• 10* FastDigest Green Buffer: 2ul
• SmaI: 1ul

Incubate into 37 degree celcius, 2h

Colonical PCR for OprF from *Psudomonus aeruginosa, micF and SoxS from K-12

PCR protocol:

For OprF, primers including OprF-F, OprF+Ter-R, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl OprF-F Primer
• 1μl OprF+Ter-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl Psudomonus aeruginosa (PAO1) bacterial solution
• 12.35μl ddH2O

For micF, primers including micF-luxI-R, micF-F, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl micF-luxI-R Primer
• 1μl micF-F Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl Top10(K-12) Strain E. coli bacterial solution
• 12.35μl ddH2O

For SoxS, primers including SoxS-RBS-luxI-R, BB-SoxS-F, protocol illustrates as:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl SoxS-RBS-luxI-R Primer
• 1μl BB-SoxS-F Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl 1μl Top10(K-12) Strain E. coli bacterial solution
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Praparation for Competent Cell

protocol as the following:

1. Pick out two single colonies(TG1) and cultivate bacteria in 5mL LB media at 37 degree centigrade about 12 hours with shocking.
2. Take 5mL nutrient solution into 100 mL media and cultivate bacteria at 37 degree centigrade about one hour and a half with shocking till the OD660 reaches 0.4-0.5.
3. Absorb 50 mL nutrient solution into EP tubes with ice-bath about 10 mins.
4. Centrifuge the tubes at 4100xg at 4 degree centigrade about 10mins and discard the supernatant liquid.
5. Utilize 30 mL 0.1M calcium chloride to suspend bacteria.
6. Centrifuge the tubes at 4100xg at 4 degree centigrade about 10 mins and discard the supernatant liquid.
7. Utilize 2 mL 0.1M calcium chloride with 15% glycerol to suspend bacteria and then ready for transformation quickly or restore at -70 degree centigrade.

Time(min)	OD600
40	0.195
60	0.203
80	0.309
90	0.439

PS:dilute the solution by adding 100 mL LB media after first test.

Negative Chemotaxis Characterization

term 1, material:

• LB solid medium plates x4
• 1g/ml Chloramphenicol
• E.coli Top10
• filter paper

Plasmid Extraction of EmrE and ArcB

done by Wang Luyao

Procedure including:

1. Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

the concentration as following

EmrE 70.2 ng/ul 92.3 ng/ul

ArcB 62.6 ng/ul 95.2 ng/ul

Transformation of R0051 and C0061

the source of parts:

No.1 R0051 2014 kit plate 4

No.2 R0051 2014 kit plate 4

No.3 control

No.4 C0061 2015 kit plate 4

No.5 C0061 2015 kit plate 4

No.6 C0061 2014 kit plate 4

No.1 and No.4 the competent cell is from lab319

No.2 and No.5 the competent cell is made by us (firt)

No.3 and No.6 the competent cell is made by us (second)

the protocol as following

1. Take the competent bacteria from refrigerator and incubate them into ice about 10 mins until it is dissolved
2. Absorb 1 uL or 2 uL plasmid and mix it with bacteria solution thoroughly.
3. Put the tubes on the ice about 30 mins.
4. Make a heat shock at 42 degree centigrade about 60 sec
5. Put the tubes on the ice about 3 mins again.
6. Add 900 ul LB medium into EP tubes and cultivate the bacteria at 37 degree centrigrade about 60 min.
7. Centrifuge them at 4,000xg about 15 sec and we will se sediment in the tubes.
8. Discard the supernatant liquid and leave about 100ul medium.
9. Coat plate: add 100ul solution in a plate

PCR of OrpF

material:

• 13 uL Taq Master Mix
• 11 uL dd water
• 1 uL PAO1 bacterial
• 0.5 uL primer Fd(OrpF-F)
• 0.5 uL primer Rv(OrpF+Ter-R)
  PS:Taq Master Mix is from lab 319 ,and this reagent is used for bacterial PCR.

Renaturation at 50℃, extend for 1:10

PCR of OprF

material:

No.1 and No.2:

• 6.5 uL Taq Master Mix
• 1 uL PAO1 bacterial solution
• 4.5 uL dd water
• 0.5 uL OprF-F
• 0.5 uL OprF+Ter-R

No.3 and No.4:

• 6.5 uL Taq Master Mix
• 4 uL OprF PCR product
• 1.5 uL dd water
• 0.5 uL OprF-F
• 0.5 uL OprF+Ter-R

PS:Taq Master Mix is from lab 319 ,and this reagent is used for bacterial PCR.

Renaturation at 55℃, extend for 1:10

OprF for PCR and gel electrophoresisOprF

analyze: the length of the product is

Preparation of Semi-Solid LB Medium

In order to characterization the movement of TOP10, semi-solid LB medium preparation is indispensable in this research.

(500mL Protocol)

Ingredients	Mass	Proportion(g/mL)
Yeast Extract	2.5g	0.5%
Trtptone	5g	1%
NaCl	5g	1%
Agar	1.25g	0.25%

Compared with solid LB medium, containing 1.5% agar in there.

Plasmid Extraction C0051,B0015 and R0062

Procedure including:

1. Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

the concentration as following

C0015:171.7 ng/uL

B0015:93 ng/uL

R0062:144.3 ng/uL

PCR of C0051,B0015 and R0062

material:

C0051 plasmid(171.7 ng/uL)

B0015 plasmid(93 ng/uL)

R0062 plasmid(144.3 ng/uL)

all the solutions are diluted 10-folds

Primers produced from Sangon Biotech Co.,Ltd.

Primers	Sequence(5' to 3')
C0051-F(I)	att tat atg agc aaa aag aaa cca tta tca
C0051-B0015-R(I)	tat ttg atg cct ggc tct agt gat cta cac tag cac ta
B0015-R(I)	gcc gct act agt taa acg cag aaa ggc cca cc
B0015-F	cca ggc atc aaa taa aac gaa agg
R0062-F	gcg gcc gct tct aga gac ctg tag gat cg
R0062-C0051-R	tgt gct cat ata aat ttt ctc ctc ttt cta gat ttt att cga c

No.1 and No.2 for C0051(803bp)

Protocol as this:

• 2.5 μl Taq buffer with KCl
• 2.5 μl dNTPs
• 0.75 μl C0051-F Primer
• 0.75 μl C0051-B0015-R(I) Primer
• 0.5 μl Taq DNA Polymerase
• 1.0 μl MgCl2
• 2 uL C0051 solution
• 15 μl ddH2O

No.3 and No.4 for B0015(142bp)

Protocol as this:

• 2.5 μl Taq buffer with KCl
• 2.5 μl dNTPs
• 0.75 μl B0015-F Primer
• 0.75 μl B0015-R(I) Primer
• 0.5 μl Taq DNA Polymerase
• 1.0 μl MgCl2
• 3 uL C0051 solution
• 14 μl ddH2O

No.5 and No.6 for R0062(104bp)

Protocol as this:

• 2.5 μl Taq buffer with KCl
• 2.5 μl dNTPs
• 0.75 μl R0062-F Primer
• 0.75 μl R0062-C0051-R Primer
• 0.5 μl Taq DNA Polymerase
• 1.0 μl MgCl2
• 2 uL R0062 solution
• 15 μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 2min(C0061)or 1min(B0015 and R0062)
4. 4 celcius degree for preserveation.

Preparation Semi-Solid M63 Medium

In order to characterization the movement of TOP10, semi-solid M63 medium preparation is indispensable in this research.

(500mL Protocol)

Ingredients	Mass	Proportion(g/mL) or Mole
Yeast Extract	2.5g	0.5%
Trtptone	5g	1%
NaCl	5g	1%
Agar	1.25g	0.25%
KH2PO4	6.8g	50mM
KOH	2.1g	37.5mM
(NH4)2SO4	0.09g	7.5mM
MgSO4	0.06g	0.5mM
FeSO4·7H2O	0.2710g	1.95mM
D-Glucose	1.98g	11mM

Colonical PCR for OprF from Psudomonus aeruginosa and SCVE from pUC57

PCR protocol:

For OprF, primers including OprF-F, OprF+Ter-R, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl OprF-F Primer
• 1μl OprF+Ter-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl Psudomonus aeruginosa (PAO1) bacterial solution
• 12.35μl ddH2O

For SCVE, Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
SCVE-T-R	TTGATGCCTGGCTCTAGTACACCAGCAGATCCGG
T7-RBS-SCVE-F	TTTTTGCATACTAGAGAAAGAGGAGAAAATTTATATGTATAGCTTTGTG

Protocol as this:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl SCVE-T-R Primer
• 1μl T7-RBS-SCVE-F Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl SCVE solution from plasmid extraction
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Gel Electrophoresis of OprF, SCVE micF and SoxS

micF and SoxS

OprF and SCVE

Gel Extraction

Material including: OprF, SoxS, micF

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Plasmid Extraction of R0062

Procedure including:

1. Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

PCR for OprF and C0061

PCR protocol:

For OprF, primers including OprF-F, OprF+Ter-R, protocol as following:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl OprF-F Primer
• 1μl OprF+Ter-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl Psudomonus aeruginosa (PAO1) bacterial solution
• 12.35μl ddH2O

For SCVE, Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
C0061-F	ATGACTATAATGATAAAAAAATCGGATTTTTTGGCA
C0061-B0015-R	ATTTGATGCCTGGGAGATCTACACTAGC

Protocol as this:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl C0061-F Primer
• 1μl C0061-B0015-R Primer
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1μl C0061 solution
• 12.35μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Gel Extraction of C0062,B0015 and R0062

Material including: C0051,B0015 and R0062

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

the concentration as following:

C0051:12.7 ng/uL

B0015:7.3 ng/uL

R0062:7.7 ng/uL

PCR of OprF

material:

• 13 uL Taq Master Mix
• 11 uL dd water
• 1 uL PAO1 bacterial
• 0.5 uL primer Fd(OrpF-F)
• 0.5 uL primer Rv(OrpF+Ter-R)

Renaturation at 55℃, extend for 2min

Gel Electrophoresis Characterization

C0051 and B0015

OprF

That was relatively successully extracted OprF from colonical PCR.

R0062

Preparation for Homologous Recombination: Plasimid Digestion

Enzyme from Thermo Scientific FastDigest Enzyme with 10X Green Buffer

Protocol as following:

• Nuclease-free water: 15ul
• pSB1C3: 1ul
• 10* FastDigest Green Buffer: 2ul
• EcoRI: 1ul
• SpeI: 1ul

Incubate solution at 37 degree celcius about 2h.

PCR of C0061,B0015 and micF

material:

C0061 plasmid: 477.1 ng/uL(diluted 20-folds)

B0015 PCR product:7.3 ng/uL

micF-1 PCR product:13.4 ng/uL

ForB0015 Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
B0015-F	cca ggc atc aaa taa aac gaa agg
B0015-R(I)	gcc gct act agt ata taa acg cag aaa ggc cca cc

protocol:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl Primer-Fd
• 1μl Primer-Rv
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• 1uL C0061 plasmid,4uL B0015 plasmid,2uL plasmid
• (13.35-X)μl ddH2O

Renaturation at 55℃, extend for 1min

PCR of C0061,B0015,R0062,R0010 and C0062

material:

C0061 plasmid:477.1 ng/uL(0.2 uL)

B0015 plasmid:19 ng/uL(3 uL)

R0062 plasmid:143.3 ng/uL(0.5 uL)

C0051 plasmid:171.7 ng/uL(0.5 uL)

R0010 plasmid:357.7 ng/uL(diluted 10-folds,1 uL)

C0062 plasmid:739.4 ng/uL(diluted 10-folds,1uL)

for R0062.R0010 and C0062Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
R0062-F	gcg gcc gct tct aga ctg tag gat cg
R0062-C0051-R	tgt gct cat ata aat ttt ctc ttt cta gat ttt att cga c
backbone-R0010-F	ccgctt cta gag cca tac gca aac cgc ctc tc
C0062-B0034-R	cta gtg tc agt aat aaa ttt tct cct ctt tg tgt gaa att gt
B0034-C0062-F	tat tac tga gca cta gat gaa aaa cat aaa tgc cga c
B0015-C0062-R	atg cct vggc tct agt gat cta cac tag cac t

protocol:

• 2μl Taq buffer with KCl
• 0.4μl dNTPs
• 1μl Primer-Fd
• 1μl Primer-Rv
• 0.25μl Taq DNA Polymerase
• 2μl MgCl2
• XuL plasmid
• (13.35-X)μl ddH2O

Renaturation at 55℃, extend for 1min

PS:

C0061:656bp B0015:142bp R0062:104bp

C0051:803bp C0062:813bp R0010:243bp

Characterization of micF and SoxS by Gel Electrophoresis

micF were successfully PCRed.

Characterization of pSB1C3 and SoxS by Gel Electrophoresis

Characterization of R0051, C0061 and C0051 by Gel Electrophoresis

Plasimid Extraction for pSB1C3 and C0061

Procedure including:

1.Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.

2.Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.

3.Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.

4.Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.

5.Centrifuge tubes at 12,000xg about 10 mins.

6.Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.

7.Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.

8.Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.

9.Do the step 8 again.

10.Centrifuge the empty columns at 12,000xg about 1 min.

11.Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

Gel Extraction

Material including: R0051, C0051 and C0061

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Characterization of B0015 and R0051 by Gel Electrophoresis

Overlap Circuit

This sensing circuit including promoter micF and SoxS.

Overlapping Fragments

In order to ligate the fragements micF or SoxS, C0061 and B0015, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

According to our sample extracted from PCR and calculation, ingradients characterize as below:

Name	Concentration(ng/uL)	Length(bp)
micF	12.6	358
SoxS	27.5	705
C0061(LuxI)	18.5	656
B0015(Terminator)	9.5	143
Total		1161

The theoratical volumn proportion is:

• SoxS-C0061-B0015: 5: 7: 3
• micF-C0061-B0015: 5.5: 7: 3

Firstly, to ligate these parts, we need 10 cycles without primer:

for circuit SoxS-C0061-B0015:

Name	Volumn(uL)
SoxS	5
C0061	7
B0015	3
Taq Polymerase	0.25
MgCl2	2
dNTP	0.4
10X buffer with KCl	2
ddH2O	0.35

for circuit micF-C0061-B0015:

Name	Volumn(uL)
micF	5.5
C0061	7
B0015	3
Taq Polymerase	0.25
MgCl2	2
dNTP	0.4
10X buffer with KCl	2

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 10 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Then, we extracted 5 ul as template, and 15 ul adding with primer:

Primers were synthesized from Sangon Biotech. Co.,Ltd.

Primers	Sequence(5' to 3')
micF-F	GCGGCCGCTTCTAGAGCCTCATTAATCAGTCGGC
B0015-R	GCCGCTACTAGTATATAAACGCAG
BB-SoxS-F	CGGCCGCTTCTAGAGCGTGCGGAACATTCG

5ul-template protocol:

Name	Volumn(uL)
Template	5
Taq Polymerase	0.25
MgCl2	2
dNTP	0.4
micF-F(BB-SoxS-F)	1
B0015-R	1
10X buffer with KCl	2
ddH2O	8.35

15ul-protocol:

Name	Volumn(uL)
Solution	15
micF-F(BB-SoxS-F)	1
B0015-R	1
10X buffer with KCl	2
ddH2O	1

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

PCR of Five Parts

material:

R0010 plasmid:193.1ng/uL

C0062 plasmid:952.5ng/uL

B0015 plasmid:93ng/uL

R0062 plasmid：143.3ng/uL

For R0051 Primers produced from Sangon Biotech Co.,Ltd.

protocol:

• 2uL 10X buffer with KCl
• 0.4uL dNTP
• 1uL primers-F
• 1uL primers-R
• 0.25uL Taq Polymerase
• 2uL MgCl2
• 1uL plasmid
• 12.35 uL ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Overlap PCR of bacteria III

material:

• R0062 PCR product:21.2 ng/uL
• C0051 PCR product:22.8 ng/uL
• B0015 PCR product:24.6 ng/uL

protocol:

total volume 20 uL

• R0062(104bp) 1 uL
• C0051(803bp) 8 uL
• B0015(153bp) 1.5uL
• ddH2O 4.85 uL
• buffer 2uL
• dNTP 0.4uL
• Taq polymerase 0.25uL
• MgCl2 2uL

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 10 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

After the 10 cycles,we divide the 20 ul system into two parts:5ul and 15ul.The 5ul PCR product will be used as template in another new 20ul system.On the other hand, add primers

(R0062-F primer 1uL;C0062-B0015-R(I) primer 1uL)to the remaining 15 uL PCR product.

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Result:

we don't get the product we want.We guess the templates are not the right products,maybe they have mutations .So we decide to do the overlap PCR of bateriaI to test whether the method is suitable.

Plasmid Extraction of gRNA-AcrB and gRNA-EmrE

Procedure including:

1. 1.Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. 2.Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. 3.Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. 4.Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. 5.Centrifuge tubes at 12,000xg about 10 mins.
6. 6.Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. 7.Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. 8.Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. 9.Do the step 8 again.
10. 10.Centrifuge the empty columns at 12,000xg about 1 min.
11. 11.Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

Gel Extraction

Material including: R0061

Case 1: Sangon Biotech.

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Case 2: Axygen

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add 400~600 ul Buffer DE-A and then incubate the EP tubes in thermostat water bath about 75 degree centigrade within 10 mins.
4. After gel is all dissolved, add 1/3 volumn of Buffer DE-B into EP tubes. The solution will turn yellow, illustrating complete dissolved.
5. Pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul Buffer W1 in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Add 700 ul Buffer W2 in a centrifuge at 9000Xg about 30s and pour out the solution.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Overlapping Fragments

We conduct the overlapping again.

However, the sample has a little difference. The concentration of micF changes to 58.7ng/uL. According to our sample extracted from PCR and calculation, ingradients characterize as below:

Name	Concentration(ng/uL)	Length(bp)
micF	57.8	358
SoxS	27.5	705
C0061(LuxI)	18.5	656
B0015(Terminator)	9.5	143
Total		1161

The theoratical volumn proportion is:

• SoxS-C0061-B0015: 5: 7: 3
• micF-C0061-B0015: 1.3: 7: 3

Firstly, to ligate these parts, we need 10 cycles without primer:

for circuit SoxS-C0061-B0015:

Name	Volumn(uL)
SoxS	5
C0061	7
B0015	3
Taq Polymerase	0.25
MgCl2	2
dNTP	0.4
10X buffer with KCl	2
ddH2O	0.35

for circuit micF-C0061-B0015:

Name	Volumn(uL)
micF	1.3
C0061	7
B0015	3
Taq Polymerase	0.25
MgCl2	2
dNTP	0.4
10X buffer with KCl	2
ddH2O	4.1

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 10 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Primers are the same as before.

Name	Volumn(uL)
Template	5
Taq Polymerase	0.25
MgCl2	2
dNTP	0.4
micF-F(BB-SoxS-F)	1
B0015-R	1
10X buffer with KCl	2
ddH2O	8.35

15ul-protocol:

Name	Volumn(uL)
Solution	15
micF-F(BB-SoxS-F)	1
B0015-R	1
10X buffer with KCl	2
ddH2O	1

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

PCR of Cas9(80l)

material:

8 uL buffer with KCl

35 uL dd water

8 uL Plasmid with Cas9

4 uL primer R

4 uL primer F

8 uL MgCl2

8 uL dNTPs

5 uL DMSO

1 uL Tap polymerase

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 4.5 min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Negative Chemotaxis Characterization

Done by Wang Luyao

Term 1 results

I put the paper on this plate after the E.coli grows homogeneously， so let's see the result later.

the controlled plate

the last plate was contaminated

Term 2

material:

LB solid medium plates x6

0.8、0.6、0.4、0.2、0.1g/ml Chloramphenicol

E.coli Top10

filter paper

Enzyme Digestion

Performing twice separately

Both as following protocol:

Name	Volumn(uL)
pSB1C3	10
XbaI	1
SpeI	1
green buffer	2
ddH2O	6

Overlap PCR of bacteriaI

material:

• micF PCR product :33.6ng/uL
• C0061 PCR product: 18.5ng/uL
• B0015 PCR product:9.2ng/uL
• micF-F primer
• B0015-R primer

protocol:

total volume: 25uL

• Taq Master Mix 12.5uL
• micF 2uL
• C0061 6uL
• B0015 2.6uL
• ddH2O 1.9uL

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 10 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 90s)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.

After the 10 cycles,we divide the 20 ul system into two parts:5ul and 15ul.The 5ul PCR product will be used as template in another new 20ul system.On the other hand, add primers

to the remaining 15 uL PCR product.

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 90s)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.

Results:

We don't get the product we want.We make some research and guess that the probable reasons are the following:Taq polymerase can cause 3'd A to PCR product;the annealing temperature is unsuitable;the length of overlap fragment isn't enough .

Negative Chemotaxis Characterization

Done by Wang Luyao

7.30

Term 2 results

The 0.8、0.6、0.4 plates just look similar, the denser Chloramphenicol the paper hold， the bigger the clear zone is.

but the 0.2 and 0.1g/ml plates are different, Top10 grows denser on the edge of the clear zone, I supposed it can show that E.coli has moved. So next time I'll try under 0.2g/ml.

The controlled plate

PCR of C0062 and R0010

material:

• 10 ul Taq PCR Master Mix
• 7 ul ddH2O
• 1 ul Primer F
• 1 ul Primer R
• 1 ul C0062 or R0010

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 4.5 min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Negative Chemotaxis Characterization

Done by Wang Luyao

Term 3, material:

• LB solid medium plates x5

• 0.2、0.1、0.05、0.025g/ml Chloramphenicol

• E.coli Top10

• filter paper

PCR of micF, SoxS, C0061 and R0015

material(volume 50uL):

• 25 ul Taq PCR Master Mix
• 15 ul ddH2O
• 2.5 ul Primer F
• 2.5 ul Primer R
• 2.5 ul Top10 culture, Top10 culture, C0061 or R0015

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 4.5 min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

PCR of tRNA

Primers	Sequence(5' to 3')
tRNA-F	GAATTCGCGGCCGCTTCTAGATAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCAATGGACGAGTTCGAAATGATT
tRNA-R	CTGCAGCGGCCGCTACTAGTTTACAGACGTTTGCGAATTG
tRNA-F2	TTTAATCCCCGTCCACTGGGTAATACGACTCACTATAGGGAATAC

Protocol (volume 20uL):

• 2 ul Taq Buffer
• 0.4 ul dNTP
• 1 ul tRNA-F
• 1 ul tRNA-R
• 0.25 ul Taq DNA Polymerase
• 2 ul MgCl2
• 1 ul tRNA
• 12.35 ul ddH2O

Protocol (volume 20uL):

• 2 ul Taq Buffer
• 0.4 ul dNTP
• 1 ul tRNA-F2
• 1 ul tRNA-R
• 0.25 ul Taq DNA Polymerase
• 2 ul MgCl2
• 1 ul tRNA
• 12.35 ul ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 25 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s ) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.

Result

Only one sample get PCR product, concentration 441ng/μL. tRNA-F2 dosen't work for wrong template.

Remember to review gene map before experiments!

PCR of cheZ

material:

Top 10 Bacterial Solution

Primers produced from Sangon Biotech Co.,Ltd.

Primers	Sequence(5' to 3')
cheZ-F	GTGCAATTGATCCAGGAGCTCAGCCAGGC
cheZ-T7-R	GCTCCTGGATCAATTGCACATAAATTTTCTCCTCTTTTGCAAAAAGAA

for cheZ (~600bp)

Protocol as this:

• 2.5 μl Taq buffer with KCl
• 2.5 μl dNTPs
• 0.75 μl cheZ-F Primer
• 0.75 μl cheZ-T7-R Primer
• 0.5 μl Kod DNA Polymerase(600bp/min)
• 1.0 μl MgCl2
• 2 uL Top10 Solution
• 15 μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1 min 30s)
3. Elongation for whole at 72 degree celcius 2min(C0061)or 1min(B0015 and R0062)
4. 4 celcius degree for preserveation.

It turned out we used wrong primer:(

PCR of CheZ and B0015

material:

• TOP 10 baterial solution
• PAO1 bacterial solution
• B0015 plasmid :93.0 ng/uL

protocol:

total system 25uL

• buffer 2.5 uL
• dNTPs 2.5uL
• MgSO4 2uL
• primer-F 0.75 uL
• primer-R 0.75 uL
• bacterial solution/plasmid 1uL
• KOD-Plus enzyme 0.5uL
• ddH2O 17uL

PCR cycle including:

1. Preheat: 94 degree celcius, 2min
2. 35 cycles containing: degradation(94 degree celcius, 15s; annealing(55 degree celcius, 30s and elongation(68 degree celcius 50s)
3. Elongation for whole at 68 degree celcius 7min.
4. 4 celcius degree for preserveation.

The protocol is from lab319,the enzyme is KOD-Plus.

Result:

We don't get the product we want .It turned out because of wrong primer we implemented.

Transformation of C0062

the protocol as following

1. Take the competent bacteria from refrigerator and incubate them into ice about 10 mins until it is dissolved
2. Absorb 1 uL or 2 uL plasmid and mix it with bacteria solution thoroughly.
3. Put the tubes on the ice about 30 mins.
4. Make a heat shock at 42 degree centigrade about 60 sec
5. Put the tubes on the ice about 3 mins again.
6. Add 900 ul LB medium into EP tubes and cultivate the bacteria at 37 degree centrigrade about 60 min.
7. Centrifuge them at 4,000xg about 15 sec and we will se sediment in the tubes.
8. Discard the supernatant liquid and leave about 100ul medium.
9. Coat plate: add 100ul solution in a plate

Negative Chemotaxis Characterzation

Done by Wang Luyao

Term 3 results

this time I got the similar results, but I cannot tell whether the bacteria is moved or didn't grow up.

so let's see the term 1 result:

I put the paper on this plate after the E.coli grows homogeneously. Now after I took it out I got this.

It's obviously that the bacteria moved. If E.coli died, the medium cannot be clear, the bodies will stay. In the middle of the area, there was a bubble formed by the medium and the wet paper. There is dilute Chloramphenicol, so the some bacteria moved there.

So we qualitatively proved that E.coli negative chemotaxis !!!

PCR of cheZ

Material:

Top 10 Bacterial Solution

Primers produced from Sangon Biotech Co.,Ltd.

Primers	Sequence(5' to 3')
cheZ-F	GTGCAATTGATCCAGGAGCTCAGCCAGGC
che-Ter-R	TTTATTTGATGCCTGGCTCTAGTATCAGAAACCCAGGCTGGACA

for cheZ (~600bp)

Protocol as this:

• 5 μl Taq buffer with KCl
• 1 μl dNTPs
• 2.5 μl cheZ-F Primer
• 2.5 μl che-Ter-R Primer
• 0.65 μl Pfu DNA Polymerase(600bp/min)
• 5 μl MgCl2
• 2.5 uL Top10 Solution
• 31 μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1 min 30s)
   1.Elongation for whole at 72 degree celcius 10 mins
3. 4 celcius degree for preserveation.

No results: May be because of Pfu enzyme has already been out of date.

Protocol again:

Ingredients	Volumn(uL)
2X Taq Master Mix	25
cheZ-F	2.5
che-Ter-R	2.5
Top10 Solution	5
ddH2O	15

Ingredients	Volumn(uL)
2X Taq Master Mix	25
cheZ-F	2.5
che-Ter-R	2.5
Top10 Solution	5
ddH2O	12.5
DMSO	2.5

No results：it turns out cheZ sequence in TOP10 is different from PAO1, we designed after PAO1

Protocol again:

Ingredients	Volumn(uL)
2X Taq Master Mix	25
cheZ-F	2.5
che-Ter-R	2.5
PAO1 Solution	5
ddH2O	15

Ingredients	Volumn(uL)
Taq buffer with KCl	5
dNTPs	1
che-Ter-R	2.5
PAO1 Solution	5
ddH2O	28.35
MgCl2	5
Taq Polymerase	0.65

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1 min)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

PCR of tRNA

Protocol (volume 20uL):

• 2 ul Taq Buffer
• 0.4 ul dNTP
• 1 ul tRNA-F2
• 1 ul tRNA-R
• 0.25 ul Taq DNA Polymerase
• 2 ul MgCl2
• 1 ul tRNA
• 12.35 ul ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s ) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.

Gel Extraction of tRNA

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Add 1.5mL Buffer B2 and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
3. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
4. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
5. Do the step 5 again.
6. Centrifuge the empty columns at 9000xg about 1min.
7. Open the columns and air them about 10 mins.
8. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 10 min and then centrifuge at 9000xg about 1 min.
9. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Result

Concentration 64ng/ul.

PCR of CheZ

material:

Top 10 Bacterial Solution

protocol:

total system 25uL

• buffer 2.5 uL
• dNTPs 2.5uL
• MgSO4 3uL
• primer-F 0.75 uL
• primer-R 0.75 uL
• bacterial solution/plasmid 1uL
• KOD-Plus-Neo enzyme 0.5uL
• ddH2O 16uL

PCR cycle including:

1. Preheat: 94 degree celcius, 2min
2. 35 cycles containing: degradation(98 degree celcius, 10s; annealing(55 degree celcius, 30s and elongation(68 degree celcius 30s)
3. Elongation for whole at 68 degree celcius 7min.
4. 4 celcius degree for preserveation.
   The protocol is from lab 319.

PCR of T7 promoter

Primers	Sequence(5' to 3')
T7-F	GAATTCGCGGCCGCTTCTAG
T7-R2	agacatgcaatttttttcattccgattttctcctcttttgcaaaaagaacaagtagct
T7 Promoter1	GAATTCGCGGCCGCTTCTAGAtaatacgactcactatagggaatacaagctacttgttctttttgca
T7 Promoter2	tgcaaaaagaacaagtagcttgtattccctatagtgagtcgtattaTCTAGAAGCGGCCGCGAATTC

Protocol (volume 20uL):

• 10 ul Mix
• 1 ul T7-F
• 1 ul T7-R2
• 1 ul T7 Promoter1
• 1 ul T7 promoter2
• 6 ul ddH2O

PCR cycle including:

1. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s ) and elongation(72 degree celcius 30s)
2. Elongation for whole at 72 degree celcius 7min.
3. 4 celcius degree for preserveation.

PCR Purification of T7

1. Add Buffer B3 in 5 times volumn of PCR product.
2. Pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
3. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
4. Do the step 5 again.
5. Centrifuge the empty columns at 9000xg about 1min.
6. Open the columns and air them about 10 mins.
7. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
8. Keep the DNA solution and measure the concentration of DNA and A260/A280 for further study.

Result

Concentration 28ng/ul.

PCR of T7 promoter

Conduct the PCR again.

Protocol (volume 20uL):

• 10 ul Mix
• 1 ul T7-F
• 1 ul T7-R2
• 1 ul T7 Promoter1
• 1 ul T7 promoter2
• 6 ul ddH2O

PCR cycle including:

1. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s ) and elongation(72 degree celcius 30s)
2. Elongation for whole at 72 degree celcius 7min.
3. 4 celcius degree for preserveation.

Seamless Clone of tRNA Plasmid

Protocol:

• 8.5 ul Seamless cloning Master Mix
• 3 ul linear PSB1C3 plasmid
• 2 ul tRNA
• 6.5 ul ddH2O
  Incubate at 50℃ for 60min.

Seamless Clone of Anchor Plasmid

Protocol:

• 8.5 ul Seamless cloning Master Mix
• 3 ul linear PSB1C3 plasmid
• 1 ul T7 promoter
• 1 ul COMPX
• 6.5 ul ddH2O
  Incubate at 50℃ for 60min.

Transformation of tRNA Plasmid & Anchor Plasmid

Procedure:

1. Add 4ul clone product to competent cells, mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. 4000rpm centrifuge for 3min, discard 500ul supernate.
5. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Plasmid Extraction of C0061

Procedure including:

1. Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

PCR of cheZ and OprF from PAO1

Yesterday, we may extract cheZ from PAO 1, though with a lot of primer dimer. Today, DMSO will be implemented trying to eliminate these fragements.

Ingredients	Volumn(uL)
Taq buffer with KCl	5
dNTPs	1
cheZ-F	2.5
cheZ-Ter-R	2.5
PAO1 Solution	5
ddH2O	25.85
MgCl2	5
Pfu Polymerase	0.65
DMSO	2.5

Ingredients	Volumn(uL)
Taq buffer with KCl	5
dNTPs	1
Opr-F	2.5
OprF-Ter-R	2.5
PAO1 Solution	5
ddH2O	25.85
MgCl2	5
Pfu Polymerase	0.65
DMSO	2.5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 2 min 30 s)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

PCR Purification of T7

1. Add Buffer B3 in 5 times volumn of PCR product.
2. Pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
3. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
4. Do the step 5 again.
5. Centrifuge the empty columns at 9000xg about 1min.
6. Open the columns and air them about 10 mins.
7. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
8. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Gel Extraction

Material including: OprF, cheZ

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

Colonial PCR of PSB1C3-T7-COMPX & PSB1C3-T7-tRNA

Protocol(volume 20ul)

• 1μl T7-F Primer
• 1μl COMPX-R or tRNA-R Primer
• 10μl Mix
• 1μl Bacteria Clone
• 7μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

No Result.

Colonial PCR of PSB1C3-T7-COMPX & PSB1C3-T7-tRNA

Conduct the PCR again.

Protocol(volume 20ul)

• 1μl T7-F Primer
• 1μl COMPX-R or tRNA-R Primer
• 10μl Mix
• 1μl Bacteria Clone
• 7μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

No Result.

PCR Purification of tRNA & COMPX

1. Add Buffer B3 in 5 times volumn of PCR product.
2. Pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
3. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
4. Do the step 5 again.
5. Centrifuge the empty columns at 9000xg about 1min.
6. Open the columns and air them about 10 mins.
7. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
8. Keep the DNA solution and measure the concentration of DNA and A260/A280 for further study.

Result

tRNA 26ng/ul, COMPX 24ng/ul.

Transformation of tRNA Plasmid & Anchor Plasmid

Procedure:

1. Add 4ul clone product to competent cells, mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. 4000rpm centrifuge for 3min, discard 500ul supernate.
5. Spread half of the bacteria culture on plate with chloramphenicol, incubate overnight at 37℃.

Colonial PCR of PSB1C3-T7-COMPX & PSB1C3-T7-tRNA

Protocol(volume 20ul)

• 1μl T7-F Primer
• 1μl COMPX-R or tRNA-R Primer
• 10μl Mix
• 1μl Bacteria Clone
• 7μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

PCR of OprF from PAO1

Yesterday, we may extract cheZ from PAO 1, though with a lot of primer dimer. Today, DMSO will be implemented trying to eliminate these fragements.

Ingredients	Volumn(uL)
Taq buffer with KCl	5
dNTPs	1
Opr-F	2.5
OprF-Ter-R	2.5
PAO1 Solution	5
ddH2O	28.35
MgCl2	5
Pfu Polymerase	0.65
DMSO	2.5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 2 min)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

PCR of C0061

material(volume 100uL):

• 6 ul MgCl2
• 71 ul ddH2O
• 4 ul Primer F
• 4 ul Primer R
• 2 ul dNTP
• 1 ul Taq DNA polymerase
• 10 ul 10*PCR Buffer
• 2 ul C0061

PCR cycle including:

1 Preheat: 94 degree celcius, 5min

2 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 4.5 min)

3 Elongation for whole at 72 degree celcius 1min

4 4 celcius degree for preserveation.

Gel Extraction

Material including: R0061

Preparation:

• Check out whether ethyl alcohol is added into Wash Solution.

• Check out whether Buffer B2 has sediment.

• Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

5 Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.

6 Measure out the weight of tubes of gel.

7 Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.

8 Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.

9 After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.

10 Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.

11 Do the step 5 again.

12 Centrifuge the empty columns at 9000xg about 1min.

13 Open the columns and air them about 10 mins.

14 Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

PCR for gRNA-AcrB and gRNA-EmrE

material:

gRNA-AcrB plasmid(280.7 ng/uL)

gRNA-EmrE plasmid(222.4 ng/uL)

PCR protocol:

For gRNA-AcrB and gRNA-EmrE, primers including gRNA-F, gRNA-R, protocol as following:

• 10μl Taq Master Mix
• 1μl gRNA-F Primer
• 1μl gRNA-R Primer
• 0.25μl Taq DNA Polymerase
• 6.75μl ddH2O
• 1μl gRNA-AcrB(or gRNA-EmrE) Plasmid

For gRNA, Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
gRNA-F	GCGTCTAGATTGACAGCTAGCTCAGTAGGTATAAT
gRNA-R	TAGTAGGTCGTATTAAAAAAAAGCACCGAC

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

gRNA-AcrB and gRNA-EmrE

Gel Extraction of gRNA-AcrB and gRNA-EmrE

Material including: gRNA-AcrB and gRNA-EmrE

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

the concentration as following:

gRNA-AcrB: 44 ng/uL

gRNA-EmrE: 41 ng/uL

PCR for T7-tet Promoter

PCR protocol:

For T7-tet promoter, primers including T7-tet-F, T7-tet-R, protocol as following:

• 10μl Taq Master Mix
• 1μl T7-tet-F Primer
• 1μl T7-tet-R Primer
• 1μl template-F Primer
• 1μl template-R Primer
• 0.25μl Taq DNA Polymerase
• 5.75μl ddH2O

Use template-F Primer and template-R Primer as templates

For T7-tet, Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
template-F	taatacgactcactatgatagaaaagaggagaaaatc
template-R	gattttctcctcttttctatcatagtgagtcgtatta
T7-tet-F	Ttaatacgactcactatgatagaaaagaggag
T7-tet-R	gtatttcttatccattccgattttctcctcttttctat

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

T7-tet Promoter

Gel Extraction of T7-tet Promoter

Material including: T7-tet Promoter

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

the concentration as following:

T7-tet: 30 ng/uL

Seamless Clone of cheZ Plasmid and Circuit Containing E0040

Protocol:

Fragements	Length(bp)	Mass Required(ug)
linear PSB1C3 plasmid	2070	41.4
T7 Promoter	46	9.2
cheZ	683	13.66
B0015	143	2.86

Ingredients	Volumn
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	3 ul
T7 Promoter	1ul(+3 folds ddH2O)
cheZ	1ul(+1 fold ddH2O)
B0015	1ul(+9 folds ddH2O)
ddH2O	5.5ul

Incubate at 50℃ for 60min.

Fragements	Length(bp)	Mass Required(ug)
linear PSB1C3 plasmid	2070	41.4
R0061	30	0.6
E0040	720	14.4
B0015	143	2.86

Ingredients	Volumn(uL)
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	3 ul
R0061	1ul(+20 fold ddH2O)
E0040	1ul(+1 fold ddH2O)
B0015	1ul(+9 folds ddH2O)
ddH2O	5.5ul

PCR for Cas9-PART I and Cas9-PART II

material:

Cas9 plasmid(511.3 ng/uL)

PCR protocol:

For Cas9-PART I and Cas9-PART II, primers including Cas9-1-F, Cas9-1-R,Cas9-2-F, Cas9-2-R, protocol as following:

• 10μl Taq Master Mix
• 1μl Cas9-1-F(or Cas9-2-F) Primer
• 1μl Cas9-1-R(or Cas9-2-R) Primer
• 0.25μl Taq DNA Polymerase
• 6.75μl ddH2O
• 1μl Cas9 Plasmid

For Cas9, Primers produced from Sangon Biotech Co.,Ltd.

Primer	Sequence(5'-3')
Cas9-1-F	ggaatggataagaaatactcaataggcttag
Cas9-1-R	gctgtttcatcaccttatcatcaaaga
Cas9-2-F	gataaggtgatgaaacagcttaaacgtc
Cas9-2-R	ctactagtgggaccattcaaaacagcatagc

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 4.5min)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

Cas9-PART I and Cas9-PART II

Gel Extraction of Cas9-PART I and Cas9-PART II

Material including: Cas9-PART I and Cas9-PART II

Preparation:

1. Check out whether ethyl alcohol is added into Wash Solution.
2. Check out whether Buffer B2 has sediment.
3. Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 5 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.
11. Keep the DNA solution and often measure the concentration of DNA and A260/A280 for further study.

the concentration as following:

Cas9-PART I : 31 ng/uL

Cas9-PART II: 16 ng/uL

Seamless Clone of tRNA Plasmid

Protocol:

• 8.5 ul Seamless cloning Master Mix
• 3 ul linear PSB1C3 plasmid
• 1 ul tRNA
• 7.5 ul ddH2O

Incubate at 50℃ for 60min.

Seamless Clone of Anchor Plasmid

Protocol:

• 8.5 ul Seamless cloning Master Mix
• 3 ul linear PSB1C3 plasmid
• 1 ul T7 promoter
• 1 ul COMPX
• 6.5 ul ddH2O

Incubate at 50℃ for 60min.

Transformation of tRNA Plasmid & Anchor Plasmid

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

PCR for micF and C0061

Protocol:

Ingradients	Volumn(uL)
10X PCR buffer	8
dNTPs	1.6
micF-F	4
micF-luxI-R	4
Top10 Solution	8
Pfu Polymerase	0.5
ddH2O	53.9

Ingradients	Volumn(uL)
10X PCR buffer	8
dNTPs	1.6
C0061-F	4
C0061-B0015-R	4
C0061	8
Pfu Polymerase	0.5
ddH2O	53.9

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min 30s)
3. Elongation for whole at 72 degree celcius 7 min
4. 4 celcius degree for preserveation.

Seamless Clone of circuit I

material:

pSB1C3(XbaI&SpeI digest) 2062bp 7.1ng/uL

micF 402bp 58.7ng/uL

C0061 656bp 27.4ng/uL

B0015 142bp 7.1ng/uL

seamless clone kit

protocol:

pSB1C3 12.4uL

micF 0.5uL

C0061 1.73uL

B0015 1.46uL

seamless clone mix 8.5uL

Incubate at 50℃ for 60min.

Transformation of circuit I

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 3min.
3. Add 500ul LB culture(no antibiotics), shaking at 37℃ for 30min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Seamless Clone of circuit I

material:

pSB1C3(XbaI&SpeI digest) 2062bp 7.1ng/uL

micF 402bp 58.7ng/uL

C0061 656bp 27.4ng/uL

B0015 142bp 7.1ng/uL

seamless clone kit

protocol:

pSB1C3 12.4uL

micF 0.5uL

C0061 1.73uL

B0015 1.46uL

seamless clone mix 8.5uL

Incubate at 50℃ for 60min.

Transformation of circuit I

Protocol:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 3min.
3. Add 500ul LB culture(no antibiotics), shaking at 37℃ for 30min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Transformation of pSB1C3

protocol:

1. Add 2ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 3min.
3. Add 500ul LB culture(no antibiotics), shaking at 37℃ for 30min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Double digest of pSB1C3

protocol:

pSB1C3 plasmid solution 10ul

XbaI 1ul

SpeI 1ul

Tango.buffer 2ul

ddH2O 6ul

incubate at 37℃ for 2 hours.

Colonial PCR of PSB1C3-T7-COMPX & PSB1C3-T7-tRNA

Protocol(volume 20ul)

• 1μl T7-F Primer
• 1μl COMPX-R or tRNA-R Primer
• 10μl Mix
• 1μl Bacteria Clone
• 7μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Colonial PCR of PSB1C3-T7-cheZ & PSB1C3-R0051-E0040-B0015

Protocol(volume 13.5ul)

• 0.25μl Primer 1
• 0.25μl Primer 2
• 6.5μl Mix
• 1μl Bacteria Clone
• 5.5μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Overlap Circuit of gRNA-Cas9

Overlapping Fragments

In order to ligate the fragements gRNA-ArcB or gRNA-EmrE, T7-tet, Cas9-PART I and Cas9-PART II, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

According to our sample extracted from PCR and calculation, ingradients characterize as below:

Name	Concentration(ng/uL)	Length(bp)
gRNA-ArcB	44	162
gRNA-EmrE	41	162
T7-tet	30	56
Cas9-PART I	31	1954
Cas9-PART II	16	2358
Total		4530

The theoratical volumn proportion is:

• gRNA-ArcB-T7-tet-Cas9-PART I-Cas9-PART II : 2: 1: 31: 64
• gRNA-EmrE-T7-tet-Cas9-PART I-Cas9-PART II: 2: 1: 31: 64

Firstly, to ligate these parts, we need 10 cycles without primer:

for circuit gRNA-ArcB-T7-tet-Cas9-PART I-Cas9-PART II:

Name	Volumn(uL)
gRNA-ArcB	0.2
T7-tet	0.1
Cas9-PART I	3.1
Cas9-PART II	6.4
Taq Polymerase	0.25
dNTP(+MgCl2)	2
10X buffer	2
DMSO	1
ddH2O	4.95

for circuit gRNA-EmrE-T7-tet-Cas9-PART I-Cas9-PART II:

Name	Volumn(uL)
gRNA-EmrE	0.2
T7-tet	0.1
Cas9-PART I	3.1
Cas9-PART II	6.4
Taq Polymerase	0.25
dNTP(+MgCl2)	2
10X buffer	2
DMSO	1.25
ddH2O	4.7

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 10 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 6.5min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Then, we extracted 5 ul as template, and 15 ul adding with primer:

Primers were synthesized from Sangon Biotech. Co.,Ltd.

Primers	Sequence(5' to 3')
gRNA-F	GCGTCTAGATTGACAGCTAGCTCAGTAGGTATAAT
Cas9-2-R	CTACTAATGGGACCATTCAAAACAGCATAGC

5ul-template protocol:

Name	Volumn(uL)
Template	5
Taq Polymerase	0.25
dNTP(+MgCl2)	2
10X buffer	2
DMSO	1.25
ddH2O	7.5
gRNA-F	1
Cas9-2-R	1

15ul-protocol:

Name	Volumn(uL)
Solution	15
gRNA-F	1
Cas9-2-R	1
DMSO	1
10X buffer	2

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 6.5min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Plasmid Extraction of Circuit 1, B0015, T7

Procedure including:

1.Absorb 6 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.

2.Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.

3.Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.

4.Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.

5.Centrifuge tubes at 12,000xg about 10 mins.

6.Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.

7.Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.

8.Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.

9.Do the step 8 again.

10.Centrifuge the empty columns at 12,000xg about 1 min.

11.Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

Enzyme Digestion

Protocol:

Name Volumn(uL)

pSB1C3 10

XbaI 1

SpeI 1

10* Buffer Tango 2

ddH2O 15

Colonial PCR of PSB1C3-T7-COMPX

Protocol(volume 20ul)

• 1μl T7-F Primer
• 1μl COMPX-R
• 10μl Mix
• 1μl Bacteria Clone
• 7μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Double Digest of T7 Plasmid

Protocol (Volume 20ul)

• 4ul Tango Buffer
• 2ul BamHI
• 2ul SalI
• 10ul T7 Plasmid
• 2ul ddH2O
  Incubate at 37℃ for 3h.

Colonial PCR of PSB1C3-T7-COMPX

Conduct the PCR again.

Protocol(volume 20ul)

• 1μl T7-F Primer
• 1μl COMPX-R
• 10μl Mix
• 1μl Bacteria Clone
• 7μl ddH2O

PCR cycle including:

1. Preheat: 94 degree celcius, 7min
2. 35 cycles containing: degradation(94 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Double Digest of T7 Plasmid

Protocol (Volume 20ul)

• 4ul Tango Buffer
• 2ul BamHI
• 2ul SalI
• 10ul T7 Plasmid
• 2ul ddH2O
• Incubate at 37℃ overnight.

Seamless Clone of circuit I

material:

pSB1C3(XbaI&SpeI digest) 2062bp 36.7ng/uL

micF 402bp 39ng/uL

SoxS 736bp 44.4ng/uL

C0061 656bp 27.4ng/uL

B0015 142bp 22ng/uL

seamless clone kit

protocol:

pSB1C3 1.12uL

micF 0.2uL or SoxS 0.33uL

C0061 0.48uL

B0015 0.14uL

seamless clone mix 8.5uL

Incubate at 50℃ for 60min.

Transformation of circuit I

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 3min.
3. Add 500ul LB culture(no antibiotics), shaking at 37℃ for 30min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Colony PCR of Circuit I

pick 16 single colonies and shaking culture for 5 hours.

protocol:

• 6.5 ul Taq Master Mix
• 5.5 ul ddH2O
• 0.25 ul C0061-F primer
• 0.25 ul C0061-B0015-R primer
• 0.5 ul bacterial solution

PCR cycle including:

1. Preheat: 95 degree celcius, 5min
2. 30 cycles containing: degradation(95 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 50 s)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

PCR of C0062

material(volume 100uL):

• 6 ul MgCl2
• 71 ul ddH2O
• 4 ul Primer F
• 4 ul Primer R
• 2 ul dNTP
• 1 ul pfu DNA polymerase
• 10 ul 10*PCR Buffer
• 2 ul C0062

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 4.5 min)
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Seamless Clone of pSB1C3-R0010-C0062-B0015

Ingredients	Volumn
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	2 ul
R0010	0.4ul
C0062	0.6ul
B0015	2.4ul
ddH2O	6.1ul

Incubate at 50 degree celcius 1 h.

Seamless Clone of pSB1C3-T7-COMPX

Ingredients	Volumn
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	2ul
T7	2ul
COMPX	1ul
ddH2O	6.5ul

Ingredients	Volumn
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	2ul
T7	1ul
COMPX	1ul
ddH2O	14.5ul

Incubate at 50 degree celcius 1 h.

Transformation of pSB1C3-T7-COMPX

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Enzyme Digestion of pSB1C3-T7-COMPX and pSB1C3-tRNA

Ingredients	Volumn
Tango Buffer	2ul
plasmid	10ul
Spe I	1ul
Xba I	1ul
ddH2O	6ul

Incubate at 37 degree celcius for 2 h.

Transformation of pSB1C3-R0010-C0062-B0015

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Transformation of pSB3A3

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. Spread on plate with Ampcilin, incubate overnight at 37℃.

Plasmid Extraction of T7

Procedure including:

1. Absorb 4.5 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.
2. Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.
3. Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.
4. Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.
5. Centrifuge tubes at 12,000xg about 10 mins.
6. Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.
7. Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.
8. Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.
9. Do the step 8 again.
10. Centrifuge the empty columns at 12,000xg about 1 min.
11. Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

PCR of OprF from PAO1

Ingredients	Volumn(uL)
2XTaq Mix	25
OprF-F	2.5
OprF-Ter-R	2.5
PAO1	2.5
ddH2O	17.5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 2 min)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

Plasmid Extraction of R0062, B0015, SCVE, T7

Procedure including:

1.Absorb 4.5 mL bacteria solution in to EP tubes, centrifuge them at 12,000xg 1mins and then discard the culture medium.

2.Add 250 ul Buffer S1 into sediment, and use spearhead to make bacteria suspended.

3.Add 250 ul Buffer S2, and overturn the EP tubes 8 times immediately and tenderly. Stand tubes about 3 mins.

4.Add 350 ul Buffer W3 and overturn the EP tubes 10 times again immediately and tenderly.

5.Centrifuge tubes at 12,000xg about 10 mins.

6.Pour the supernatant liquid into absorption columns ,centrifuge them at 12,000xg about 30 sec and then discard the liquid in the collecting pipe.

7.Add 500 ul Buffer W1 and centrifuge them at 12,000xg about 30 sec. Then discard the liquid in the collecting pipe.

8.Add 700 ul Buffer W2, centrifuge them at 12,000xg about 30 sec and discard the liquid in the collecting pipe.

9.Do the step 8 again.

10.Centrifuge the empty columns at 12,000xg about 1 min.

11.Put the columns in clean 1.5mL EP tubes, add 80 ul Elution Buffer on the absorption film, stand 10 min and centrifuge about 1 min at 12,000xg.

PCR of R0062, C0051, E0040, B0015

Ingredients	Volumn(uL)
PCR Buffer	5
Primer 1	2.5
Primer 2	2.5
Plasimid Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min 30 s)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

Pre-annealing of R0051

Ingredients	Volumn(uL)
R0051-F1	10
R0051-R1	10

Incubate solution in 95 degree celcius 30 min and then used for PCR.

PCR of R0051, T7-OprF, T7-SCVE, SCVE, micF and soxS

Ingredients	Volumn(uL)
PCR Buffer	5
Primer 1	2.5
Primer 2	2.5
Plasimid Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 2min)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

PCR of OprF, micF, SoxS

Ingredients	Volumn(uL)
PCR Buffer	5
Primer 1	2.5
Primer 2	2.5
Bacterial Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min 30 s)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

Gel Extraction

Material including: R0061, E0040, B0015, T7-OprF

Preparation:

• Check out whether ethyl alcohol is added into Wash Solution.

• Check out whether Buffer B2 has sediment.

• Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

5 Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.

6 Measure out the weight of tubes of gel.

7 Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.

8 Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.

9 After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.

10 Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.

11 Do the step 5 again.

12 Centrifuge the empty columns at 9000xg about 1min.

13 Open the columns and air them about 10 mins.

14 Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

PCR of OprF, SoxS, micF

Ingredients	Volumn(uL)
PCR Buffer	5
Primer 1	2.5
Primer 2	2.5
Bactieral Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(Temperature gradient: 48 degree celcius, 50 degree celcius, 53 degree celcius and 55 degree celcius 30s) and elongation(72 degree celcius 2min)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

Gel Extraction

Material including: T7-SCVE, SCVE

Preparation:

• Check out whether ethyl alcohol is added into Wash Solution.

• Check out whether Buffer B2 has sediment.

• Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

5 Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.

6 Measure out the weight of tubes of gel.

7 Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.

8 Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.

9 After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.

10 Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.

11 Do the step 5 again.

12 Centrifuge the empty columns at 9000xg about 1min.

13 Open the columns and air them about 10 mins.

14 Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min

Enzyme Digestion of pSB1C3

incubate at 37 degree celcius about 2 h

Ingredients	Volumn(uL)
Enzyme 1	1
Enzyme 2	1
pSB1C3	4
Tango Buffer	4
ddH2O	10

strategy	Enzyme 1	Enzyme 2
Strategy 1	EcoRI	PstI
Strategy 2	EcoRI	SpeI
Strategy 1	XbaI	PstI
Strategy 2	XbaI	SpeI

PCR of C0061, micF/SoxS-binding C0061

for C0061

Ingredients	Volumn(uL)
PCR Buffer	5
C0061-F	2.5
C0061-B0015-RI	2.5
Plasimid Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

for micF-C0061

Ingredients	Volumn(uL)
PCR Buffer	5
micF-R-BB	2.5
B0034-C0061-R	2.5
Plasimid Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

for SoxS-C0061

Ingredients	Volumn(uL)
PCR Buffer	5
SoxS-R-BB	2.5
B0034-C0061-R	2.5
Plasimid Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 2min)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

Seamless ligation of pSB1C3-T7-SCVE-B0015

Ingradients	Volumn(uL)
pSB1C3	1.2
T7-SCVE	1
SCVE	1
B0015	1
Seamless Cloning mix	8.5
ddH2O	to 20

Incubate at 50 degree celcuis 1 h

PCR of OprF, SoxS

Ingredients	Volumn(uL)
PCR Buffer	5
Primer 1	2.5
Primer 2	2.5
Bacterial Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min 30 s)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

PCR of micF-C0061

Ingredients	Volumn(uL)
PCR Buffer	5
micF-F-BB	2.5
B0034-C0061-R	2.5
Bacterial Solution	2.5
ddH2O	31.9
Pfu Polymerase	0.6
dNTP mix	5

PCR cycle including:

1. Preheat: 94 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min 30 s)
3. Elongation for whole at 72 degree celcius 10 mins
4. 4 celcius degree for preserveation.

Gel Extraction

Material including: micF, pSB1C3

Preparation:

• Check out whether ethyl alcohol is added into Wash Solution.

• Check out whether Buffer B2 has sediment.

• Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

5 Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.

6 Measure out the weight of tubes of gel.

7 Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.

8 Optional: If the length of the DNA strip is shorter than 500 bp, it would be better add isopropanol one third volume of Buffer B2.

9 After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s.

10 Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.

11 Do the step 5 again.

12 Centrifuge the empty columns at 9000xg about 1min.

13 Open the columns and air them about 10 mins.

14 Put the columns into clean 1.5 mL EP tubes and add 15-40uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Ligation of pSB1C3-tRNA

incubate at 16 degree celcius more than 20 h

Ingredients	Volumn(uL)
T4 DNA ligation Buffer	2
T4 DNA ligase	1
pSB1C3 digested by EcoRI and PstI	1
tRNA	6
ddH2O	11

Seamless Cloning of pSB1C3-micF-C0061-B0015

Ingredients	Volumn
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	2 ul
micF	1ul
C0061	1ul
B0015	1ul
ddH2O	6.5ul

Incubate at 50℃ for 60min.

Seamless Cloning of pSB1C3-T7-COMPX

Ingredients	Volumn
Seamless cloning Master Mix	8.5 ul
linear PSB1C3 plasmid	2 ul
COMPX	1ul
ddH2O	8.5ul

Incubate at 50℃ for 60min.

Transformation of pSB1C3-micF-C0061-B0015 and pSB1C3-T7-COMPX

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 500ul SOC culture, incubate at 37℃ for 45min.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Construction of cheZ

PCR of CheZ

CheZ:

Material(volume 50ul)

CheZ-BB-F:1ul

CheZ-BB-R:1ul

Primestar:25ul

ddH2O:21ul

PAO1:2ul

Divide the 50ul into 2 parts. Both are

25ul

PCR cycle including:

1. Preheat: 98 degree celcius, 5min
2. 35 cycles containing: Degradation(94 degree celcius, 30s; Annealing(55 degree celcius, 30s and elongation(72 degree celcius 1.5 min).
3. Elongation for whole at 72 degree celcius 1min
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

CheZ(PCR)

Gel Extraction

Material including: CheZ(PCR)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 6 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Double digest of CheZ and PSB1C3

Detect the concentration of CheZ:16.9ng/ul

Volume:20ul

Material:

CheZ:15ul

EcoRI:1ul

PstI:2ul

Tango:2ul

37℃digest 2 hours.

Detect the concentration of PSB1C3:74.1ng/ul

Volume:20ul

Material:

PSB1C3:5ul

EcoR1:1ul

Pst1:2ul

Tango:2ul

ddH2O:10ul

37℃digest 2 hours.

Gel Electrophoresis Characterization

CheZ(ep)

PSB1C3(ep)

Gel Extraction

Material including: CheZ(ep)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Ligation of PSB1C3 and CheZ

In order to ligate the CheZ and PSB1C3, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

C1V1/n1=C2V2/n2=……=0.1~0.3

Among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

At first, we need the mass of PSB1C3 at 50ng. The concentrate of the plasmid we use is 8.4ng/ul while the one of the CheZ is 16.7ng/ul. So we choose to add 6ul into the reaction. Through the relation of the mole of DNA, we get the volume of the CheZ.

Material:

CheZ:4ul

PSB1C3:6ul

Solution I:10ul

16℃ligate over night, prepare for the Transformation of the next day.

Transformation of CheZ and PSB1C3 Plasmid

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 900ul LB culture, incubate at 37℃ for 60min. Centrifuge the culture at 4000×1min, give away 850ul culture.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Colonial PCR of CheZ

Take one bacterial colony into 10ul H2O for the PCR.

Protocol(volume 13ul)

• 1μl CheZ-BB-F
• 1μl CheZ-BB-R
• 10μl Mix
• 1μl Bacteria Clone

PCR cycle including:

1. Preheat: 98 degree celcius, 7min
2. 35 cycles containing: degradation(98 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

Failed.

However, we incubate two of the bacteria into 50ul centrifuge tube at 37℃, we find it grow well.

Construction of T7-SCVE

PCR of T7 and SCVE

Preparation:

Add 10ul T7-F,10ul T7-R ,heating at 95 degree celcius for 30min and cool to 37 degree celcius.The mix will be used as template for the PCR.

Material(volume 50ul)

T7-exten-F:1ul

T7-exten-R:1ul

Primestar:25ul

ddH2O:18ul

T7 as template:5ul

Divide the 50ul into 2 parts. Both are

25ul

Material(volume 50ul)

SCVE-F:1ul

SCVE-R:1ul

Primestar:25ul

ddH2O:22ul

SCVE plasmid:1ul

Divide the 50ul into 2 parts. Both are

25ul

PCR cycle including:

1. Preheat: 98 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1 min)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.
   Gel Electrophoresis Characterization
   T7(PCR)

Gel Electrophoresis Characterization

T7(PCR)

SCVE(PCR)

Gel Extraction

Material including: T7,SCVE(PCR)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Double digest of T7 and SCVE

Detect the concentration of T7:35ng/ul

Volume:20ul

Material:

T7:15ul

XbaI:1ul

HindIII:2ul

Tango:2ul

37℃digest 2 hours.

Detect the concentration of SCVE:7.8ng/ul

volume:20ul

Material:

SCVE:15ul

PstI:1ul

HindIII:1ul

bufferR:2ul

ddH2O:1ul

37℃digest 2 hours.

Detect the concentration of PSB1C3:160.2ng/ul

Volume:20ul

Material

PSB1C3:5ul

XbaI:1ul

Pst1:2ul

Tango:2ul

ddH2O:10ul

37℃digest 2 hours.

Gel Electrophoresis Characterization

T7(ep)

SCVE(ep)

PSB1C3(xp)

Gel Extraction

Material including: T7,SCVE(ep)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Ligation of PSB1C3 ,T7 and SCVE

In order to ligate the T7,SCVE and PSB1C3, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

C1V1/n1=C2V2/n2=……=0.1~0.3

Among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

Material:

T7:1ul

SCVE:2ul

PSB1C3:6ul

Solution I:10ul

16℃ligate over night, prepare for the Transformation of the next day.

Transformation of T7+SCVE Plasmid

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 900ul LB culture, incubate at 37℃ for 60min. Centrifuge the culture at 4000×1min, give away 850ul culture.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Colonial PCR of T7+SCVE

Take one bacterial colony into 10ul H2O for the PCR.

Protocol(volume 13ul)

• 1μl T7-exten-F

• 1μl T7-exten-R

• 10μl Mix

• 1μl Bacteria Clone

PCR cycle including:

1. Preheat: 98 degree celcius, 7min
2. 35 cycles containing: degradation(98 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization
T7+SCVE

T7-SCVE(PCR detection)

Then take one of the positive bacteria into 50ul centrifuge tube, incubate at 37℃.

Construction of T7-OprF

PCR of OprF

Material(volume 50ul)

OprF-F:1ul

OprF-R:1ul

Primestar:25ul

ddH2O:21ul

top10:2ul

Divide the 50ul into 2 parts. Both are

25ul

PCR cycle including:

1. Preheat: 98 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.
   the protocol of pcr of T7 is the same as the above

Gel Electrophoresis Characterization

OprF(PCR)

Gel Extraction

Material including: OprF(PCR)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Double digest of T7 and OprF

Detect the concentration of T7:23ng/ul,OprF:40ng/ul

Volume:20ul

Material:

T7:15ul

EcoRI:1ul

NdeI:1ul

bufferO:2ul

ddH2O:1ul

37℃digest 2 hours.

Material:

OprF:15ul

PstI:1ul

NdeI:1ul

bufferO:2ul

ddH2O:1ul

37℃digest 2 hours.

Detect the concentration of PSB1C3:160.2ng/ul

Volume:20ul

Material

PSB1C3:5ul

EcoR1:1ul

Pst1:2ul

Tango:2ul

ddH2O:10ul

37℃digest 2 hours.

Gel Electrophoresis Characterization

OprF(ep)

T7(ep)

Gel Extraction

Material including: OprF(ep)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Ligation of T7,OprF and pSB1C3

In order to ligate the T7,OprF and PSB1C3, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

C1V1/n1=C2V2/n2=……=0.1~0.3

Among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

Material:

T7:1ul

OprF:2.5ul

PSB1C3:6ul

Solution I:10ul

16℃ligate over night, prepare for the Transformation of the next day.

Transformation of T7+OprF Plasmid

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 900ul LB culture, incubate at 37℃ for 60min. Centrifuge the culture at 4000×1min, give away 850ul culture.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Colonial PCR of T7+OprF

Take one bacterial colony into 10ul H2O for the PCR.

Protocol(volume 13ul)

• 1μl T7-exten-F
• 1μl OprF-R
• 10μl Mix
• 1μl Bacteria Clone

PCR cycle including:

1. Preheat: 98 degree celcius, 7min
2. 35 cycles containing: degradation(98 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

T7-OprF

Then take one of the positive bacteria into 50ul centrifuge tube, incubate at 37℃.

Construction of lac+cheZ

PCR of lac and cheZ

Material(volume 50ul)

EcoRI-lac-F:1ul

NdeI-lac-R:1ul

Primestar:25ul

ddH2O:22ul

template:1ul

Divide the 50ul into 2 parts. Both are

25ul

Material(volume 50ul)

NdeI-cheZ-F:1ul

PstI-his-cheZ-R:1ul

Primestar:25ul

ddH2O:22ul

template:1ul

Divide the 50ul into 2 parts. Both are

25ul

PCR cycle including:

1. Preheat: 98 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.
   the protocol of pcr of T7 is the same as the above

Gel Electrophoresis Characterization

CheZ(PCR)

R0010(PCR)

Gel Extraction

Material including: lac and cheZ(PCR)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Double digest of lac and cheZ

Detect the concentration of lac:45ng/ul cheZ:38ng/ul

Volume:20ul

Material:

R0010:15ul

EcoRI:1ul

NdeI:1ul

bufferO:2ul

ddH2O:1ul

37℃digest 2 hours.

Material:

cheZ:15ul

PstI:1ul

NdeI:1ul

bufferO:2ul

ddH2O:1ul

37℃digest 2 hours.

Gel Electrophoresis Characterization

R0010(np)

CheZ(xn)

Gel Extraction

Material including: lac and cheZ(ep)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Ligation of lac ,cheZ and pSB1C3

In order to ligate the lac,cheZ and PSB1C3, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

C1V1/n1=C2V2/n2=……=0.1~0.3

Among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

Material:

lac:0.5ul

cheZ:3.0ul

PSB1C3:6ul

Solution I:10ul

16℃ligate over night, prepare for the Transformation of the next day.

Transformation of lac+cheZ Plasmid

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 900ul LB culture, incubate at 37℃ for 60min. Centrifuge the culture at 4000×1min, give away 850ul culture.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Colonial PCR of lac+cheZ

Take one bacterial colony into 10ul H2O for the PCR.

Protocol(volume 13ul)

• 1μl EcoRI-lac-F
• 1μl NdeI-lac-R
• 10μl Mix
• 1μl Bacteria Clone

PCR cycle including:

1. Preheat: 98 degree celcius, 7min
2. 35 cycles containing: degradation(98 degree celcius, 30s), annealing(55 degree celcius, 30s) and elongation(72 degree celcius 1.5 min)
3. Elongation for whole at 72 degree celcius 10min.
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

lac+cheZ

Then take one of the positive bacteria into 50ul centrifuge tube, incubate at 37℃.

Construction of micF(SoxS)-GFP

PCR of micF(SoxS) and GFP

Material(volume 50ul)

micF(SoxS)-F-BB:1ul

micF(SoxS)-E0040-R:1ul

Primestar:25ul

ddH2O:22ul

template:1ul

Divide the 50ul into 2 parts. Both are

25ul

Material(volume 50ul)

E0040-F:1ul

E0040-R:1ul

Primestar:25ul

ddH2O:22ul

template:1ul

Divide the 50ul into 2 parts. Both are

25ul

PCR cycle including:

1. Preheat: 98 degree celcius, 5min
2. 35 cycles containing: degradation(94 degree celcius, 30s; annealing(55 degree celcius, 30s and elongation(72 degree celcius 1min)
3. Elongation for whole at 72 degree celcius 10min
4. 4 celcius degree for preserveation.

Gel Electrophoresis Characterization

micF and SoxS(PCR)

E0040(PCR)

Gel Extraction

Material including: micF(SoxS) and GFP(PCR)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Double digest of micF(SoxS) and GFP

Detect the concentration of micF:100ng/ul

SoxS:80ng/ul GFP:65ng/ul

Volume:20ul

Material:

micF:15ul

XbaI:1ul

HindIII:1ul

Tango buffer:2ul

ddH2O:1ul

37℃digest 2 hours.

Material:

GFP:15ul

PstI:1ul

HindIII:1ul

bufferR:2ul

ddH2O:1ul

37℃digest 2 hours.

Gel Electrophoresis Characterization

micF and SoxS(xH)

GFP(PH)

Gel Extraction

Material including: micF(SoxS) and GFP(ep)

Preparation:

•Check out whether ethyl alcohol is added into Wash Solution.

•Check out whether Buffer B2 has sediment.

•Adjust the thermostat water bath at 50 degree centigrade.

Procedure:

1. Cut up the effective bands under UV light and put the fragments into EP tubes with series numbers.
2. Measure out the weight of tubes of gel.
3. Add Buffer B2 3 to 6 times the volume of gel and then incubate the EP tubes in thermostat water bath about 50 degree centigrade about 10 mins.
4. Add isopropanol one third volume of Buffer B2.
5. After gel is all dissolved, pour the solutions into absorption columns and centrifuge columns at 8000xg about 30s, then add the solutions into the absorption columns again and centrifuge columns again.
6. Add 500 ul wash solution in a centrifuge at 9000Xg about 30s and pour out the solution.
7. Do the step 10 again.
8. Centrifuge the empty columns at 9000xg about 1min.
9. Open the columns and air them about 10 mins.
10. Put the columns into clean 1.5 mL EP tubes and add 20uL Elution Buffer(2.5mM Tris-HCL,PH 8.5)(also can be substituted by TE or double distilled water). Stand about 1 min and then centrifuge at 9000xg about 1 min.

Ligation of micF(SoxS), GFP and pSB1C3

In order to ligate the micF(SoxS), GFP and PSB1C3, we need to make the equal mole proportion.

The mole of DNA molecule is calculated in the following ways:

C1V1/n1=C2V2/n2=……=0.1~0.3

Among which, c is the concentration of DNA, V is the volumn required and n is the length of DNA. Because of the same molar mass of As, Gs, Cs and Ts, computation of same molar mass is omitted.

Material:

micF(SoxS):0.8ul

GFP:2.0ul

PSB1C3:6ul

Solution I:10ul

16℃ligate over night, prepare for the Transformation of the next day.

Transformation of micF(SoxS)+GFP Plasmid

Procedure:

1. Add 4ul clone product to competent cells, 1mix well, incubate on ice for 30min.
2. Heat in 42℃ bath for 90s. Then put on ice for 5min.
3. Add 900ul LB culture, incubate at 37℃ for 60min. Centrifuge the culture at 4000×1min, give away 850ul culture.
4. Spread on plate with chloramphenicol, incubate overnight at 37℃.

Then take two bacteria colony into 50ul centrifuge tube, incubate at 37℃.

Then take one of the positive bacteria into 50ul centrifuge tube, incubate at 37℃.

Pre-experiment

Use 1ug/ml Chloromycetin activated the bacteria to test the film.

Film test

Film

Film type:low-pressure polyethylene.

Use the aerosol paint to process one of the surface of the film.

Coating the film with 400ul 20ug/ml PLL(Poly-L-Lysine) at the temperature of 4℃ for over 4 hours.

Bacteria solution

Bacteria type: BL21+OprF

Mix bacteria with PBS and make the OD~0.3.

Sample solution

1ug/ml Chloromycetin PBS solution.

Inoculation

Drop 200ul bacteria solution on the processed film for 100s

After 100s, wash the film with wash solution twice Immediately.

Record images

Put the film into the sample box filled with samplw solution.

Put the sample box in SPRING and push or pull the sample box at the recommended position, and rotate the sample box to get clear interference fringes.

From 0s to 240s, take 2~3 pictures in a row with the time interval of 20s.

Results

Fail to get the ideal interference fringes.

Cause reflectance is not good enough and have a small amount of diffuse reflection.

Pre-experiment

Use 1ug/ml Chloromycetin activated the bacteria to test the film.

Film

Film type: Rubbers（Condom）

1,Use the aerosol paint to process one of the

surface of the film.

Fail.Because the film shrink too much.

2,Try silver mirror reaction.

Fail.Because the ammonia erosion is too severe.

Film

Film type:glass(cover clip——thickness~0.16mm width~2.5cm longth~3.7cm)

Use the aerosol paint to process one of the surface of the film.

Coating the film with 400ul 20ug/ml PLL(Poly-L-Lysine) at the temperature of 4℃ for over 4 hours.

Bacteria solution

Bacteria type: BL21+OprF

Mix bacteria with PBS and make the OD~0.3.

Sample solution

1ug/ml Chloromycetin PBS solution.

Inoculation

Drop 200ul bacteria solution on the processed film for 100s

After 100s, wash the film with wash solution twice Immediately.

Record images

Put the film into the sample box filled with samplw solution.

Put the sample box in SPRING and push or pull the sample box at the recommended position, and rotate the sample box to get clear interference fringes.

From 0s to 240s, take 2~3 pictures in a row with the time interval of 20s.

Results

Succeed in getting the excellent interference fringes.

Record data and process the image.

Building Calibration

Film test

Sample solution

（1）5ug/ml Chloromycetin PBS solution.

（2）0.5ug/ml Chloromycetin PBS solution.

Bacteria solution

Bacteria type: BL21+OprF

Mix bacteria with PBS and make the OD~0.3.

Inoculation

Drop 200ul bacteria solution on the processed film for 100s

After 100s, wash the film with wash solution twice Immediately.

Record images

Put the film into the sample box filled with samplw solution.

Put the sample box in SPRING and push or pull the sample box at the recommended position, and rotate the sample box to get clear interference fringes.

From 0s to 240s, take 2~3 pictures in a row with the time interval of 20s.

Results

Succeed in getting the excellent interference fringes.

Record data and process the image.

Use the Matlab to process the image.

Get the fitting according to the modeling so get the calibration.

Verifying Calibration

Film test

Sample solution

（1）1.8ug/ml Chloromycetin PBS solution.

（2）3.2ug/ml Chloromycetin PBS solution.

Bacteria solution

Bacteria type: BL21+OprF

Mix bacteria with PBS and make the OD~0.3.

Inoculation

Drop 200ul bacteria solution on the processed film for 100s

After 100s, wash the film with wash solution twice Immediately.

Record images

Put the film into the sample box filled with samplw solution.

Put the sample box in SPRING and push or pull the sample box at the recommended position, and rotate the sample box to get clear interference fringes.

From 0s to 240s, take 2~3 pictures in a row with the time interval of 20s.

result

Process the gotten images and get the △N.

Calculate the △N and get the concentration is 1.80ug/ml and 3.09ug/ml.