Difference between revisions of "Team:Cork Ireland/Parts"

Line 424: Line 424:
 
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>

Revision as of 23:39, 18 September 2015

Basehunter Home

Loading menubar.....

55bp HPV Detector (K1698001)

Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAAAAGCTt cagccattaggtgtgggcattagtggCACTGC

Description goes here

Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.

For protocol for construction of detector by digestion of plasmid see HERE. The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length. The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see (STANDARDISATION OF RESULTS section)

The sequence of this part with K584001 biobrick part may be found on the Registry of Standsrd Parts.

For more information on how the detector plasmid worked see (RESULTS : DETECTORS)

Assessment of this detector parts selectivity may also be seen here (RESULTS : SELECTIVITY)

Description goes here

62bp SRY (K1698002)

Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTTATGGGTA CCAATAATAAAAGCTTGTGGTCCCGTGGTGAGAGGCACAAGTTGGCACTGC

Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.

For protocol for construction of detector by digestion of plasmid see HERE

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts

For more information on how the detector plasmid worked see (RESULTS : DETECTORS)

Description goes here

32bp SRY Detector (K1698003)

Sequence: GCTCTTCAgttgcctcaacaaaactgGTACCAAT AATAAAAGCTtacaaccttctgcaCACTGC

Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome. For protocol for construction of detector by digestion of plasmid see HERE. The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see (STANDARDISATION OF RESULTS section).

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see (RESULTS : DETECTORS)

Description goes here

24bp TB Detector (K1698004)

Sequence: GCTCTTCTCAGCCTTCCCGgtacctaattcggatcCGCTGGCTACCCCACTGC

Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome For protocol for construction of detector by digestion of plasmid see HERE. The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see (RESULTS : DETECTORS)

Description goes here