Difference between revisions of "Team:Marburg/Members"

 
Line 738: Line 738:
 
<li><b>Favorite Scientist:</b> Richard Dawkins</li>
 
<li><b>Favorite Scientist:</b> Richard Dawkins</li>
 
<li><b>Project:</b> Cut off</li>
 
<li><b>Project:</b> Cut off</li>
<li><b>Known As:</b> The Lady Killer</li>
+
<li><b>Known As:</b> The Yeast Beast</li>
 
</ul>
 
</ul>
 
</p>
 
</p>

Latest revision as of 09:03, 9 November 2015

Students

Anna Knörlein

  • My Sequence: GCAAACAACGCA
  • Age: 23
  • Field of Study: Chemistry
  • Favorite Amino Acid: Phenylalanine
  • Protein: Membrane Protein
  • Favorite Scientist: Richard P. Feynman
  • Project: ILS/Measurement
  • Known As: Master of Organization

Matthias Franz

  • My Sequence: ATGGCCACCACTCATATTGCTAGC
  • Age: 23
  • Field of Study: Chemistry
  • Favorite Amino Acid: Arginine
  • Protein: Zinc Finger
  • Favorite Scientist: Richard Dawkins
  • Project: Provide
  • Known as: The Grammar N... Nerd

Andreas Herdlitschka

  • My Sequence: GCAAACGACTAT
  • Age: 27
  • Field of Study: Chemistry
  • Favorite Amino Acid: Phenylalanine
  • Protein: TIM Barrel
  • Favorite Scientist: Elias James Corey
  • Project: Pick up
  • Known as: Landy (Lab Andy)

Lisa Engelsberger

  • My Sequence: TTAATCAGCGCA
  • Age: 25
  • Field of study: Chemistry
  • Favorite Amino Acid: Glycine
  • Protein: TIM Barrel
  • Favorite Scientist: Alexander von Humboldt
  • Project: Provide
  • Known As: Bavarian thunder

Trésor Kivoloka

  • My Sequence: ACGCGCGAATCCNNNAGG
  • Age: 26
  • Field of Study: Social Science
  • Favorite Amino Acid: Isoleucine
  • Protein: TIM Barrel
  • Favorite Scientist: Klaus Hurrelmann
  • Project: Human Practices
  • Known As: Dance Machine

Katrin Beuthert

  • My Sequence: AAAGCCACTAGAATCAAT
  • Age: 21
  • Field of study: Chemistry
  • Favorite Amino Acid: Selenocysteine
  • Protein: Prion Protein
  • Favorite Scientist: Clara Immerwahr
  • Project: Wiki
  • Known as: Wiki Wizard

Daniel Stukenberg

  • My Sequence: GATGCGAACATCGAATTA
  • Age: 22
  • Field of Study: Biology
  • Favorite Amino Acid: Valine
  • Protein: Membrane Protein
  • Favorite Scientist: Emil von Behring
  • Project: Cut off
  • Known as: Only true biologist

Alexandra Richter

  • My Sequence: GCCCTAGAANNN
  • Age: 24
  • Field of study: Chemistry
  • Favorite Amino Acid: Cysteine
  • Protein: Zinc Finger
  • Favorite Scientist: Johannes Kepler
  • Project: Pick up
  • Known as: Crystal girl

Andreas Feser

  • My Sequence: A rhesus negative, allergic to birch pollen
  • Age: 33
  • Field of Study: Media studies
  • Favorite Amino Acid: Asparagine
  • Protein: TIM Barrel
  • Favorite Scientist: Marshall McLuhan
  • Project: Human Practices, Graphics
  • Known As: Mandy (Media Andy)

Sascha Grobe

  • My Sequence: AGTGCAAGCTGTCACGCG
  • Age: 24
  • Field of Study: Chemistry
  • Favorite Amino Acid: Methionine
  • Protein: Membrane Protein
  • Favorite Scientist: Johan Vaaler
  • Project: Cut off
  • Known as: Mr. Hoodie

Maik Luu

  • My Sequence: AUGGCCAUCAAA
  • Age: 21
  • Field of Study: Biomedical Science
  • Favorite Amino Acid: Lysine
  • Protein: Membrane Protein
  • Favorite Scientist: Jules Hoffmann
  • Known as: Mr. SoLuution

Advisors

Anne Löchner

  • My Sequence: GCAAACAATGAA
  • Age: 26
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Proline
  • Protein: Membrane Protein
  • Favorite Scientist: Rosalind Franklin
  • Project: ILS/General Organization
  • Known as: Mommy

Max Mundt

  • My Sequence: ATGGCANNN
  • Age: 28
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Tryptophane
  • Protein: Alcohol Dehydrogenase
  • Favorite Scientist: Richard Dawkins
  • Project: Cut off
  • Known As: The Yeast Beast

Nicolas Koutsoubelis

  • My Sequence: AACATCTGTNNN
  • Age: 26
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: p-Benzoyl-L-phenylalanine
  • Protein: Zinc Finger
  • Favorite Scientist: Timothy Lu
  • Project: Provide
  • Known As: Daddy

Oliver Schauer

  • My Sequence: O_TTGATCGTGGAACGT
  • Age: 28
  • Field of Studies: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Cysteine
  • Protein: Zinc Finger
  • Favorite Scientist: Stephen Hawking
  • Project Pick up
  • Known As: Two face

Daniel Schindler

  • My Sequence: GATGCGAACATCGAATTA
  • Age: 30
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Selenocystein
  • Protein: TIM Barrel
  • Favorite Scientist: Gregor Mendel
  • Project: Provide
  • Known As: The Experienced

Daniel Hürtgen

  • My Sequence: GATGCGAACATCGAATTA
  • Age: 27
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Glycine
  • Protein: Zinc Finger
  • Favorite Scientist: Craig Venter
  • Known As: Protein Pro

iGEM Marburg - ZSM Karl-von-Frisch-Straße 16, D - 35043 Marburg