Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"
Line 1: | Line 1: | ||
{{Template:Paris_Bettencourt}} | {{Template:Paris_Bettencourt}} | ||
<html> | <html> | ||
− | <b> | + | <b>13/07</b> |
<ul> | <ul> | ||
− | <li> | + | <li>Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.</li> |
+ | |||
+ | Dilution in water and PCR amplification, using the following protocol: | ||
+ | <ul> | ||
+ | <li>1 μL gBlock (0.1 to 1ng) | ||
+ | <li>1 μL forward primer (10 μM) | ||
+ | <li>1 μL reverse primer (10 μM) | ||
+ | <li>22 μL DNAse/RNAse free water | ||
+ | <li>25 μL LifeTech MasterMix (2X) | ||
</ul> | </ul> | ||
− | <b>Friday, Jul. 24</b> | + | <b>RibA</b> + <b>o15.001</b> (GCGCCCGAAGACTTATGCAG) + <b>o15.002</b>(GGCCCCGCGCATATGAAG)</br> |
+ | <b>RibD</b> + <b>o15.003</b>(CGCTATAGAAGACTTGAGAAGATCTG) + <b>o15.004</b>(GCGCGGCACCACATATGAAG)</br> | ||
+ | <b>RibE</b> + <b>o15.005</b>(CGGCTATAGAAGACTTGCGC) + <b>o15.006</b>(CGCGCCGGCATATGAAGA)</br> | ||
+ | <b>RibT25</b> + <b>o15.007</b>(CCGCGTATAGAAGACTGCTAGA) + <b>o15.008</b>(CAGCAGCATATGAAGACAACCC)</br> | ||
+ | <b>RibT48</b> + <b>o15.009</b>(GCGGTATAGAAGACTGCTAGAGA) + <b>o15.010</b>(CAGCAGCATATGAAGACAACCC)</br> | ||
+ | </br> | ||
+ | For each PCR reaction, a negative control without matrix DNA was prepared.</br> | ||
+ | |||
+ | 30sec at 98°C</br> | ||
+ | 12 cycles</br> | ||
+ | 10sec at 98°C</br> | ||
+ | 30sec at 52°C</br> | ||
+ | 1min at 72°C</br> | ||
+ | </br> | ||
+ | 10min at 72°C</br> | ||
+ | until opening at 12°C</br> | ||
+ | </br> | ||
+ | </br><b>Friday, Jul. 24</b> | ||
<ul> | <ul> | ||
<li>Made the project, it is awesome!</li> | <li>Made the project, it is awesome!</li> |
Revision as of 14:54, 10 August 2015
13/07
- Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT. Dilution in water and PCR amplification, using the following protocol:
- 1 μL gBlock (0.1 to 1ng)
- 1 μL forward primer (10 μM)
- 1 μL reverse primer (10 μM)
- 22 μL DNAse/RNAse free water
- 25 μL LifeTech MasterMix (2X)
- Made the project, it is awesome!