Difference between revisions of "Team:Marburg/Members"

Line 730: Line 730:
 
<p style="font-size:13pt;line-height:150%;text-align:left;">
 
<p style="font-size:13pt;line-height:150%;text-align:left;">
 
<ul style="list-style:none;">
 
<ul style="list-style:none;">
<li><b>sedht</b>aetha</li>
+
<li><b>My Sequence:</b> O_TTGATCGTGGAACGT</li>
<li><b>shd</b>sdeths</li>
+
<li><b>Age:</b> 28</li>
<li><b>hestga</b>sa</li>
+
<li><b>Field of Studies:</b> Synthetic Biology-PhD Student</li>
<li><b></b></li>
+
<li><b>Favorite Amino Acid:</b> Cysteine</li>
<li><b></b></li>
+
<li><b>Protein:</b> Zinc Finger</li>
<li><b></b></li>
+
<li><b>Favorite Scientist:</b> Stephen Hawking</li>
<li><b></b></li>
+
<li><b>Project</b> Pick up</li>
<li><b></b></li>
+
<li><b>Known As:</b> Two faces</li>
 
</ul>
 
</ul>
 
</p>
 
</p>

Revision as of 19:11, 16 September 2015

Anna Knörlein

  • My Sequence: GCAAACAACGCA
  • Age: 23
  • Field of Study: Chemistry
  • Favorite Amino Acid: Phenylalanine
  • Protein: Membrane Protein
  • Favorite Scientist: Richard P. Feynman
  • Project: ILS/Measurement
  • Known As: Master of Organiszation

Matthias Franz

  • My Sequence: ATGGCCACCACTCATATTGCTAGC
  • Age: 23
  • Field of Study: Chemistry
  • Favorite Amino Acid: Arginine
  • Protein: Zinc Finger
  • Favorite Scientist: Richard Dawkins
  • Project: Provide
  • Known as: The Grammar N... Nerd

Andreas Herdlitschka

  • My Sequence: GCAAACGACTAT
  • Age: 27
  • Field of Study: Chemistry
  • Favorite Amino Acid: Phenylalanin
  • Protein: TIM Protein
  • Favorite Scientist: Elias James Corey
  • Project: Pick up
  • Known as: Landy (Lab Andy)

Lisa Engelsberger

  • My Sequence: TTAATCAGCGCA
  • Age: 25
  • Field of study: Chemistry
  • Favorite Amino Acid: Glycine
  • Protein: TIM-Barrel
  • Favorite Scientist: Alexander von Humboldt
  • Project: Provide
  • Known As: Bavarian thunder

Tresor Kivoloka

  • My Sequence: ACGCGCGAATCCNNNAGG
  • Age: 26
  • Field of Study: Social Science
  • Favorite Amino Acid: Isoleucin
  • Protein: TIM protein
  • Favorite Scientist: Klaus Hurrelmann
  • Project: Human Practices
  • Known As: Dance Machine

Katrin Beuthert

  • My Sequence: AAAGCCACTAGAATCAAT
  • Age: 21
  • Field of study: Chemistry
  • Favorite Amino Acid: Selenocystein
  • Protein: Prion Protein
  • Favorite Scientist: Clara Immerwahr
  • Project: Wiki
  • Known as: Wiki Wizard

Daniel Stukenberg

  • My Sequence: GATGCGAACATCGAATTA
  • Age: 22
  • Field of Study: Biology
  • Favorite Amino Acid: Valin
  • Protein: Membrane Protein
  • Favorite Scientist: Emil von Behring
  • Project: Cut off
  • Known as: Only true biologist

Alexandra Richter

  • My Sequence: GCCCTAGAANNN
  • Age: 24
  • Field of study: Chemistry
  • Favorite Amino Acid: Cystein
  • Protein: Zinc Finger
  • Favorite Scientist: Johannes Kepler
  • Project: Pick up
  • Known as: Crystal girl

Andreas Feser

  • My Sequence: A rhesus negative, allergic to birch pollen
  • Age: 33
  • Field of Study: Media studies
  • Favorite Amino Acid: Asparagin
  • Protein: TIM barrel
  • Favorite Scientist: Marshall McLuhan
  • Project: Human Practices, Graphics
  • Known As: Mandy (Media Andy)

Sascha Grobe

  • My Sequence: AGTGCAAGCTGTCACGCG
  • Age: 24
  • Field of Study: Chemistry
  • Favorite Amino Acid: Methionin
  • Protein: Membrane Protein
  • Favorite Scientist: Johan Vaaler
  • Project: Cut off
  • Known as: Mr. Hoodie

Maik Luu

  • My Sequence: AUGGCCAUCAAA
  • Age: 21
  • Field of Study: Biomedical Science
  • Favorite Amino Acid: Lysine
  • Protein: Membrane Protein
  • Favorite Scientist: Jules Hoffmann
  • Known as: Mr. SoLuution

Anne Löchner

  • My Sequence: GCAAACAATGAA
  • Age: 26
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Proline
  • Protein: Membrane Protein
  • Favorite Scientist: Rosalind Franklin
  • Project: ILS/General Organization
  • Known as: Mommy

Max Mundt

  • My Sequence:ATGGCANNN
  • Age: 28
  • Field of Study: PhD in Synthetic Microbiology
  • Favorite Amino Acid: Tryptophane
  • Protein: Alcohol Dehydrogenase
  • Favorite Scientist: Richard Dawkins
  • Project: Cut off
  • Known As: The Lady Killer

Nicolas Koutsoubelis

  • My Sequence: AACATCTGTNNN
  • Age: 26
  • Field of Study: Synthetic Biology-PhD Student
  • Favorite Amino Acid: p-benzoyl-l-phenylalanine
  • Protein: Zinc Finger
  • Favorite Scientist:
  • Project:
  • Known As: iGEM Sugar Daddy

Oliver Schauer

  • My Sequence: O_TTGATCGTGGAACGT
  • Age: 28
  • Field of Studies: Synthetic Biology-PhD Student
  • Favorite Amino Acid: Cysteine
  • Protein: Zinc Finger
  • Favorite Scientist: Stephen Hawking
  • Project Pick up
  • Known As: Two faces

Daniel Schindler

  • sedhtaetha
  • shdsdeths
  • hestgasa

Daniel Hürtgen

  • My Sequence: GATGCGAACATCGAATTA
  • Age: 27
  • Field of Study: PhD Student in Synthetic Biology
  • Favorite Amino Acid: Glycine
  • Protein:
  • Favorite Scientist: Craig Venter
  • Known As:Protein Pro

iGEM Marburg - ZSM Karl-von-Frisch-Straße 16, D - 35043 Marburg