Difference between revisions of "Team:SZU China/Basic parts"

Line 1: Line 1:
−
{{Template:SZU_China/Playground/style}}
 
−
{{Template:SZU_China/Playground/menu}}
 
 
<html>
 
<html>
 
<head>
 
<head>
 +
<link rel="stylesheet" type="text/css"  href="https://2015.igem.org/Template:SZU_China/Playground/bootstrap/CSS?action=raw&ctype=text/css" />
 +
 +
 +
 +
<!-- Latest compiled and minified JavaScript -->
 +
<script src="https://2015.igem.org/Template:SZU_China/bootstrap/Javascript?action=raw&ctype=text/javascript"></script>
 +
 +
 +
<!--custom css file-->
 +
<link href="https://2015.igem.org/Template:SZU_China/Playground/custom/CSS?action=raw&ctype=text/css" rel="stylesheet">
  
−
<link href="https://2015.igem.org/Template:SZU_China/Playground/Parts/CSS?action=raw&ctype=text/css" rel="stylesheet">
+
<link href="https://2015.igem.org/Template:SZU_China/Playground/title/CSS?action=raw&ctype=text/css" rel="stylesheet">
 
</head>
 
</head>
 
</html>
 
</html>
 +
{{Template:SZU_China/Playground/menu}}
 +
 
<html>
 
<html>
 
<body>
 
<body>
  
−
<div class="content-box">
+
 
−
    <div class="content-heading">
+
   
−
         <h1>Improved parts</h1>
+
<div class="text-title">
−
         </div>
+
<div class="texts">
−
     <div class="content-text">
+
         <p id="heading">Improved parts</p>
 +
         <p id="brief">Combine Biological Unnatural Amino Acid（UAA）Orthogonal
 +
            <br>genectical system with logic "AND" gate gene circuit
 +
            <br>to detect bladder cancer cells precisely</p>
 +
    </div>
 +
</div>
 +
 
 +
 
 +
     <div class="container" style="padding:20px;">
 +
 
 +
   
 +
      <div class="row">
 +
 
 +
        <div class="col-sm-8 blog-main">
 +
 
 +
          <div class="blog-post">
 +
            <h2 class="blog-post-title">Improved parts</h2>
 +
<div class="content-text">
 
       <div class="improved part">
 
       <div class="improved part">
 
           <div class="row">
 
           <div class="row">
 +
 +
 +
 +
  <div class="col-sm-4">
 +
            <div class="part_name">
 +
                <h3>SV40+Rluc</h3>
 +
            </div>
 +
            <div class="part_info">
 +
                <p><a href="http://parts.igem.org/Part:BBa_K1722012">detail</a><br> 
 +
SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced.
 +
</p>
 +
            </div>
 +
            </div>
 +
         
 +
 +
 
               <div class="col-sm-4">
 
               <div class="col-sm-4">
 
           <div class="part_name">
 
           <div class="part_name">
−
               <h3>part1</h3>
+
               <h3>hUPⅡ+AckRS</h3>
 
               </div>
 
               </div>
 
               <div class="part_info">
 
               <div class="part_info">
−
                 <p>ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT</p>
+
                 <p><a href="http://parts.igem.org/Part:BBa_K1722007">detail</a><br>
 +
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)
 +
</p>
 
                 </div>
 
                 </div>
 
               </div>
 
               </div>
Line 28: Line 73:
 
             <div class="col-sm-4">
 
             <div class="col-sm-4">
 
             <div class="part_name">
 
             <div class="part_name">
−
                 <h3>part2</h3>
+
                 <h3>hTERT+tRNA</h3>
 
             </div>
 
             </div>
 
             <div class="part_info">
 
             <div class="part_info">
−
                 <p>ACGTGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCTAGCTAGCT</p>
+
                 <p><a href="http://parts.igem.org/Part:BBa_K1722010">detail</a><br>
 +
hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out.
 +
</p>
 
             </div>
 
             </div>
 
             </div>
 
             </div>
 
              
 
              
−
            <div class="col-sm-4">
+
     
−
            <div class="part_name">
+
−
                <h3>part3</h3>
+
−
            </div>
+
−
            <div class="part_info">
+
−
                <p>ACGTGTCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCTAGCT</p>
+
−
            </div>
+
−
            </div>
+
 
              
 
              
 
             </div>
 
             </div>
Line 56: Line 96:
 
</div>
 
</div>
  
 +
     
 +
       
 +
 +
   
 +
 +
 +
      </div><!-- /.row -->
 +
 +
    </div><!-- /.container -->
  
 
<script src="https://2015.igem.org/Template:SZU_China/bootstrap/Javascript?action=raw&ctype=text/javascript"></script>
 
<script src="https://2015.igem.org/Template:SZU_China/bootstrap/Javascript?action=raw&ctype=text/javascript"></script>
 
</body>
 
</body>
 
</html>
 
</html>

Revision as of 13:49, 17 September 2015

Improved parts

Combine Biological Unnatural Amino Acid（UAA）Orthogonal
genectical system with logic "AND" gate gene circuit
to detect bladder cancer cells precisely

Improved parts

SV40+Rluc

detail
SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced.

hUPⅡ+AckRS

detail
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)

hTERT+tRNA

detail
hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out.

Other parts

part 4:


ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT

part 5:


ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT