Difference between revisions of "Team:UFSCar-Brasil/results.html"
Celio.dias (Talk | contribs) |
Celio.dias (Talk | contribs) |
||
Line 52: | Line 52: | ||
<h5 class="ui center aligned header"><b>Table 1.</b>Stress situations capable to induce the element PuspA. Response is given as a ratio of increase in signal of tested cells when compared with control cells.</h5> | <h5 class="ui center aligned header"><b>Table 1.</b>Stress situations capable to induce the element PuspA. Response is given as a ratio of increase in signal of tested cells when compared with control cells.</h5> | ||
+ | |||
+ | <p>The force of this genetic element is important for construction of several devices, since environmental monitoring of toxic compounds to devices of triggered expression like this specific situation. We have drawn the sequence for an improved PuspA promoter from an analysis of 400bp upstream the Universal Protein A (UspA) gene in E. coli K12. First we have used the Scope tool (http://genie.dartmouth.edu/scope/), and we found the domain WWRBAM:</p> | ||
+ | |||
+ | <img class="ui centered image" src="https://static.igem.org/mediawiki/parts/4/4c/UFSCariGEM2015_WWRBAM_domain.jpg"> | ||
+ | |||
+ | <h5 class="ui center aligned header"><b>Figure 1.</b> Domain WWRBAM obtained from analysis of 400pb upstream starting of UspA gene, using Scope.</h5> | ||
+ | |||
+ | <p>This analysis indicated to us the sequence 5'-AAGCAT-3' as vital and potential component of promoter region. Restarting the analysis with Neural Network Promoter Predictor (http://www.fruitfly.org/seq_tools/promoter.html), the following sequence was obtained:</p> | ||
+ | |||
+ | <p>5' – TGAGTTTTCAATCACCTTTCCATCCACCTTATATTAAGCATGGAGG - 3' </p> | ||
+ | |||
+ | <p>This sequence has a transcription starting at bolded T (-10) and italicized the sigma factor binding sites. The confidence of the promotion activity of this sequence was estimated as 100%. Using this part attached to the iGEM prefix and suffix through polymerase chain reaction (PCR), the construction of pSB1C3 derived vector was carried out with current assembly methods, as shown below (the orientation is 5' > 3'):</p> | ||
+ | |||
+ | <img class="ui centered image" src="https://static.igem.org/mediawiki/parts/0/04/UFSCariGEM2015_pUSPA.jpg"> | ||
+ | |||
+ | <h5 class="ui center aligned header"><b>Figure 2.</b> Promoter final construct.</h5> | ||
+ | |||
+ | <p>Interestingly, the lineages carrying these plasmids have a slow growth behavior, in comparison to cells carrying the pSB1C3 plasmid. In order to report its activity, we have fusioned the biobrick part BBa_E0840 (RBS/B0030+GFP/E0040+Terminator/B0015) downstream to our promoter making other new biobrick. This construct was used to evaluate the puspA element activity. Since the start, we observed a green color in colonies of E. coli DH5α after their growth at 37°C and posterior incubation for 16h at 4°C in lysogenic agar supplemented with chloramphenicol 10 μg/mL (LB agar plus Chloram.). These colonies were selected and passed through a confirmatory polymerase chain reaction. The best producing clone was selected and used for further experimentation and plasmid production.</p> | ||
+ | |||
+ | <div class="ui vertical stripe segment container"> | ||
+ | <h4 class="ui header" id="overview"><b>Cold shock performance</b></h4> | ||
+ | |||
+ | <p>The E. coli DH5α clone carrying the construct puspA::gfp was grown in 100 mL of lysogenic broth containing chloramphenicol as previously referred (LB plus chloram) in a 500 mL Erlenmeyer flask under 200 rpm at 37°C. After culture reach optical density of 0.5, a sample of 5 mL was collected for protein analysis. The remaining broth was transferred to a 4°C chamber without agitation for 16 h. The cells were harvested by centrifugation. The protein analysis was carried out through a SDS-PAGE, using normalized samples, and a GFP fluorescence reading in black Elisa plates using Viktor (Perkin-Elmer).</p> | ||
<div class="ui vertical stripe segment container"> | <div class="ui vertical stripe segment container"> |
Revision as of 15:02, 17 September 2015
Results
What did we observe?
Plasmolysis
Main objective of this section is to verify the viability of Escherichia coli cells under treatments with polyethylene glycol (PEG 6000) for different time lapses, and the retaken of metabolism after plasmolysis. To this, we submited this organism to different concentrations of PEG 6000 and have assessed its growth hability. Assays of plasmolysis induction were performed using Escherichia coli K-12 strain Dh5α cells obtained from a culture in lysogeny broth until an optical density at 600 nm of ~ 1.5-2.0, finally cells were harvested by centrifugation and washed with sterile 0.9% saline. Cells were resuspended in plasmolysis media (2% (vo./vol.) glycerol, 50 mM sodium acetate, 10 mM zinc chloride) containing various different concentrations of PEG 6000 (5, 10, 15, 20, 25 and 30% wt/vol). Proportion of cells in the final solution was 0.1% wt/vol. All media and their corresponding sterile controls were kept in triplicate at room temperature.
Primary spectrophotometry analysis, by checking optical density at 600 nm of all triplicates with different concentrations of PEG 6000, as well as the control medium without PEG showed cell growth was inhibited with increasing PEG 6000 concentrations used for stress condition induction (Figure 1).
Figure 1: Experimental plot of absorbance versus time in different PEG 6000 concentration.
Figure 1 shows no significant variation of weekly results with increasing PEG 6000 concentration. Optical density of bacterial suspension decreased with rising of PEG 6000 concentration. The growth could be verified since environment concerned an available carbon source for the microorganism, as glycerol. Cells number in the suspension influences the absorbance readings directly, however, possible cells arrangement and conformational changes could help formation of mobile cell complexes changes which affect considerably obtained data. It is due to light reflection direct linking with conformational and structural arrangement of these cells. To verify this, microscopy experiments were carried out through the Gram method (Figure 2).
Figure 2: Cells conformational changes in optical microscopy reveals cell arangement to reduce entropy in medium through hydrophobic interactions.
Above images show increasing PEG concentration in solution inducing formation of cells complexes. This can demonstrate a thermodynamically favorable response to the presence of an extremely hydrophilic molecule in the medium. It is expected that those cells suffer a soft osmotic stress and come into plasmolysis more easily. All this process, could avoid the loss of viability even in solutions containing high contents of osmolyte. Cell viability after plasmolysis, as well as the viability of the control medium without polyethylene glycol were verified weekly by direct plating of 100ul of each triplicate in LB solid medium, also concurrently with the plating serial dilutions in solid medium. The counting of colony forming units demonstrated that viability decreased to zero in control samples, without polyethylene glycol, for about a month and one week. But, in samples containing PEG 6000, this viability was kept (Figure 3).
Figure 3: Viability after 7 Weeks.
During tests carried out, some optical density readings of triplicates containing 25% of PEG 6000 returned unexpected values and were further investigated as possible contamination signs. Some triplicate platings were done on solid medium and optical microscopy assessment was done. It was found to Staphylococcus sp. contamination in those samples, and after they were excluded. Preliminary results indicate a promising maintenance of bacterial viability at room temperature using plasmolysis. Our results still indicate concentrations near 15% PEG 6000 representing the best option for this purpose. It is possible to note that cells viability suffers a decline in concentrations higher or lower than 15%. Possibly, lower osmolyte concentrations are not enough to promote plasmolysis efficiently, whereas higher concentrations may generate a irreversible osmotic stress frame, not supported by the microorganism (Paga & MacKey, 2000). In this sense, concentrations over 15% osmolyte concentrations can severely inhibit the molecular activity of cells, as shown by other authors, which further investigated this effect in gene induction (Rojas et al., 2014) and proteins synthesis (Clark and Parker, 1984).
Promoter UspA
The universal stress protein A is a response of Escherichia coli cells to growth arrest, and its lacking generates cells with defective growth. For more information about this important protein, please feel free to visit the respective Wikigenes page (https://www.wikigenes.org/e/gene/e/948007.html). The universal stress protein A promoter (also as known as PuspA) is a well characterized promoter element, inducible under several stress conditions (Prytz et al. 2003; Dyk et al. 1995; Nyström and Neidhardt 1992; 1994). This genetic element is dependent to sigma-70 factor (Nyström and Neidhardt 1992; 1994). Its regulation is done through the concentration of a specific stationary phase allormone, guanosine-5'-diphosphate-3'-diphosphate (ppGp), as described elsewhere (Farewell et al. 1998b). The ppGp activate the transcription of downstream elements through a positive regulation of the β-subunit of RNA polymerase. In this sense, the PuspA element is considered a stationary phase promoter. However, in the work of Prytz et al. (2003) a constitutive transcription promotion was observed. Diverse conditions make the Escherichia coli cell enter to stress state, like heat shocks, starvation, osmotic stress, ultraviolet light and other conditions. In these situations, the RNA polimerase sigma factors (ropS) trigger the expression of chaperones and other stress protector molecules, in order to help the cell survive. Previous works have showed the power of the element PuspA, like shown in the Table 1.
Table 1.Stress situations capable to induce the element PuspA. Response is given as a ratio of increase in signal of tested cells when compared with control cells.
The force of this genetic element is important for construction of several devices, since environmental monitoring of toxic compounds to devices of triggered expression like this specific situation. We have drawn the sequence for an improved PuspA promoter from an analysis of 400bp upstream the Universal Protein A (UspA) gene in E. coli K12. First we have used the Scope tool (http://genie.dartmouth.edu/scope/), and we found the domain WWRBAM:
Figure 1. Domain WWRBAM obtained from analysis of 400pb upstream starting of UspA gene, using Scope.
This analysis indicated to us the sequence 5'-AAGCAT-3' as vital and potential component of promoter region. Restarting the analysis with Neural Network Promoter Predictor (http://www.fruitfly.org/seq_tools/promoter.html), the following sequence was obtained:
5' – TGAGTTTTCAATCACCTTTCCATCCACCTTATATTAAGCATGGAGG - 3'
This sequence has a transcription starting at bolded T (-10) and italicized the sigma factor binding sites. The confidence of the promotion activity of this sequence was estimated as 100%. Using this part attached to the iGEM prefix and suffix through polymerase chain reaction (PCR), the construction of pSB1C3 derived vector was carried out with current assembly methods, as shown below (the orientation is 5' > 3'):
Figure 2. Promoter final construct.
Interestingly, the lineages carrying these plasmids have a slow growth behavior, in comparison to cells carrying the pSB1C3 plasmid. In order to report its activity, we have fusioned the biobrick part BBa_E0840 (RBS/B0030+GFP/E0040+Terminator/B0015) downstream to our promoter making other new biobrick. This construct was used to evaluate the puspA element activity. Since the start, we observed a green color in colonies of E. coli DH5α after their growth at 37°C and posterior incubation for 16h at 4°C in lysogenic agar supplemented with chloramphenicol 10 μg/mL (LB agar plus Chloram.). These colonies were selected and passed through a confirmatory polymerase chain reaction. The best producing clone was selected and used for further experimentation and plasmid production.
Cold shock performance
The E. coli DH5α clone carrying the construct puspA::gfp was grown in 100 mL of lysogenic broth containing chloramphenicol as previously referred (LB plus chloram) in a 500 mL Erlenmeyer flask under 200 rpm at 37°C. After culture reach optical density of 0.5, a sample of 5 mL was collected for protein analysis. The remaining broth was transferred to a 4°C chamber without agitation for 16 h. The cells were harvested by centrifugation. The protein analysis was carried out through a SDS-PAGE, using normalized samples, and a GFP fluorescence reading in black Elisa plates using Viktor (Perkin-Elmer).
References
PAGA, R.; MACKEY, B. Relationship between Membrane Damage and Cell Death in Pressure-Treated Escherichia coli Cells: Differences between Exponential – and Stationary – Phase Cells and Variation among Strains. Applied And Environmental Microbiology. 2000.
CLARK, D.; PARKER, J. Proteins induced by high osmotic pressure in Escherichia coli. FEMS Microbiology Letters. 1984.
ROJAS, E.; THERIOT, J. A.; HUANGA, K. C. Response of Escherichia coli growth rate to osmotic shock. Department of Bioengineering. Stanford University. 2014.