Preparing DNA and Running in Gel Electrophoresis

Reagents:

1. 10X TBE Buffer
2. Deionized Water
3. Agarose Powder
4. Gel Loading Dye Purple 6X spiked with SYBRGold
5. DNA solutions
6. DNA Ladder

Equipment:

1. Gel Doc-it UV imaging machine (Purple and grey with green tape)
2. Computer with Launch VisionWorksLS program open
3. Gel electrophoresis Box (with non-morphed electrodes) and Lid
4. Power Supply box
5. Microwave
6. Rotation Mixer
7. Weight

Methods:

• Protocol 1: Preparing the Gel

1. Create 500 mL of 1X TBE buffer by mixing 50 mL of 10X TBE buffer and 450 mL of deionized H20
2. For a 1% (w/v) gel (for very large DNA), take 50 mL of 1X TBE buffer and mix with the appropriate percent mass of Agarose powder (Weigh out 0.5 g for a 1% gel)
3. Mix thoroughly using the rotation mixer (optional)
4. Loosely plug flask with paper towel and heat in microwave for approximately 1 minute, or until the agarose is fully dissolved. The liquid should be completely clear.
5. Once completed, wait till the beaker cools and prepare to add solution to the gel tray. Put comb into the tray and make sure that the tray is oriented in the gel box so that its ends are blocked against the sides of the box.
6. SLOWLY pour solution into gel tray to avoid creating bubbles.
7. Allow gel to solidify and cool for 20 - 30 minutes or until fully solidified. This can be tested by how easy it is to move the pick.
8. Once solidified, gently turn the gel tray with the gel so that the ends are exposed.
9. Fill the gel box with 1X TBE buffer until gel is fully covered (0.5 - 1 cm above gel)
10. Slowly and carefully remove the comb so as not to tear the wells.

• Protocol 2: Staining the DNA Samples and Running Gel

Caution: Gel box has high voltage! Be sure to turn off power pack and unplug leads before removing lid of gel box.

1. You will be staining the DNA using Professor Bernick’s Droplet Technique. Depending on how many samples you have (including controls and DNA ladder), place 1 uL droplets of 6X Loading Dye on a piece of parafilm.
2. Take 5 uL of each DNA sample and add to an individual droplet. You will have a final volume of 6uL. Be sure to mix thoroughly up and down, then take the sample and inject into a well.

• Make sure to change pipet tips for each DNA sample so as to prevent contamination! Keep track of the positions of each sample

1. Once all samples have been loaded, close the gel box and attach all electrodes to the gel box and to the power pack. (Use color coding to be sure all electrodes are attached correctly. Black = negative electrode and Red = positive. The electrode closest to the samples will be negative while the further is positive.
2. Turn on the power pack and set to 120 V. You should immediately see bubbles rising from the wires in the gel box.
3. Run continuously for 75 minutes. Once complete, turn of the power pack.

• Protocol 3: Visualizing the Gel

1. Remove the lid from the gel box (Be sure that the power pack is turned off!)
2. Pour out the 1x TBE buffer into the used TBE buffer beaker
3. Open the Gel Doc it door and pull out the UV transilluminator. (Make sure it is off!)
4. Transfer the gel to the UV transilluminator tray, push it back into the machine and flip the on switch on the lower right corner.
5. Close the door and make sure the knob is turned to Syber Gold. Go to the computer and open the Launch VisionWorks program.
6. Flick the UV light switch and press preview on the computer. When the gel is clearly visible and you can see the bands, press capture and save it to the folder IGEM2015.

References:

Ruben, Giulia, “Lab 2 Protocol #1, Gel Electrophoresis”, Biochemistry Laboratory, Winter 2015

Colony PCR Protocol for Transformed E. coli

Equipment

1. Thermocycler
2. Micro-pipettes (P10, P20 & P1000)
3. Thin-walled PCR Tubes
4. Eppendorf tubes
5. Microcentrifuge with PCR and Eppendorf tube adapters
6. Ice bucket and ice (Ice is found in the Autoclave room 202)

Reagents

1. Fresh Miliq water (Found in the Autoclave room 202)
2. SOC Media
3. Titaq 2x Master Mix

Methods

After plating your electroporated E. coli cells, choose about 6 large cultures with the least amount of micro satellites.

Take a micropipet tip and gently touch it to the colony (No need to scrape as this will be too many cells)

Place the micropipet into an eppendorf tube with 10 uL of water to create a 1:10 dilution of DNA, and slowly pipet up and down to lyse the cells.

Take 1uL of this dilution and use it as DNA template for your PCR reaction

• Plasmid Specific Primer Options

• Breakdown Primers:

• bGlu_Seq_Fw1: 5’ CCCTCGATTTTCCGCCTGCCGATTA 3’
• bGlu_Seq_Rv4: 5’ GCGCTCTAGAACTAGTGGATCCCCC 3’

• Dominic Primers:

• Aldy5Seq1F: 5’-TACTTCACATTCGCGGACCTATTG - 3’
• Aldy5Seq5R: 5’-AGAACTAGTGGATCCCCCG - 3’

1. Professor Bernick Primers:

• PCR Ingredients

Components	25 uL Reaction
Titaq 2x Master Mix	12.5 uL
Forward Primer	0.5 uL
Reverse Primer	0.5 uL
Template DNA	1 uL
PCR Enhancer	5 uL
Miliq Water	5.5 uL

References

Professor David Bernick, Lab Advisor

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.