Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"

Line 22: Line 22:
 
For each PCR reaction, a negative control without matrix DNA was prepared.</br>
 
For each PCR reaction, a negative control without matrix DNA was prepared.</br>
 
</br>
 
</br>
−
<table style="width:100%">
+
<table style="width:50%">
  
 
   <tr>
 
   <tr>
Line 70: Line 70:
 
     <td>12</td>
 
     <td>12</td>
 
     <td>storage</td>
 
     <td>storage</td>
 +
  </tr>
 +
</table>
 +
<table style="width:50%">
 +
  <tr>
 +
    <td>
 +
<ul>
 +
<b>PCR purification using QIAGEN kit</b>
 +
<li>Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down
 +
<li>Transfer in a centrifugation column
 +
<li>Centrifuge 1 min at 14000 rpm
 +
<li>Throw the filtration product
 +
<li>Add 700μL of washing solution
 +
<li>Centrifuge 1 min at 14000 rpm
 +
<li>Throw the filtration product
 +
<li>Add 500μL of washing solution
 +
<li>Centrifuge 1 min at 14000 rpm
 +
<li>Throw the filtration product
 +
<li>Centrifuge 1 min at 14000 rpm
 +
<li>Throw the filtration product
 +
<li>Put the column in a sterile 1.5mL microcentrifuge tube
 +
<li>Add 45μL of DNAse/RNAse free water on the membrane
 +
<li>Wait 2 minutes
 +
<li>Centrifuge 2min at 10000rpm
 +
<li>Discard the column, DNA is saved in water
 +
    </td>
 +
  </tr>
 +
</ul>
 +
</br>
 +
</br>
 +
Concentrations measured with a Nanodrop:
 +
 +
<table style="width:50%">
 +
  <tr>
 +
    <td>  </td>
 +
    <td>[PCR product with gBlock] (ng/μL)</td>
 +
    <td>[PCR product without gBlock] (ng/μL)</td>
 +
  </tr>
 +
 +
  <tr>
 +
    <td>RibA</td>
 +
    <td>3.5</td>
 +
    <td>3.4</td>
 +
  </tr>
 +
 +
  <tr>
 +
    <td>RibD</td>
 +
    <td>6.4</td>
 +
    <td>3.3</td>
 +
  </tr>
 +
 +
  <tr>
 +
    <td>RibE</td>
 +
    <td>5.0</td>
 +
    <td>3.7</td>
 +
  </tr>
 +
 +
  <tr>
 +
    <td>RibT25</td>
 +
    <td>3.5</td>
 +
    <td>3.8</td>
 +
  </tr>
 +
 +
  <tr>
 +
    <td>RibT48</td>
 +
    <td>8.7</td>
 +
    <td>3.3</td>
 
   </tr>
 
   </tr>
 
</table>
 
</table>

Revision as of 15:28, 10 August 2015

13/07
  • Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.
    • Dilution in water and PCR amplification, using the following protocol:
    • 1 μL gBlock (0.1 to 1ng)
    • 1 μL forward primer (10 μM)
    • 1 μL reverse primer (10 μM)
    • 22 μL DNAse/RNAse free water
    • 25 μL LifeTech MasterMix (2X)

    RibA + o15.001 (GCGCCCGAAGACTTATGCAG) + o15.002(GGCCCCGCGCATATGAAG)
    RibD + o15.003(CGCTATAGAAGACTTGAGAAGATCTG) + o15.004(GCGCGGCACCACATATGAAG)
    RibE + o15.005(CGGCTATAGAAGACTTGCGC) + o15.006(CGCGCCGGCATATGAAGA)
    RibT25 + o15.007(CCGCGTATAGAAGACTGCTAGA) + o15.008(CAGCAGCATATGAAGACAACCC)
    RibT48 + o15.009(GCGGTATAGAAGACTGCTAGAGA) + o15.010(CAGCAGCATATGAAGACAACCC)

    For each PCR reaction, a negative control without matrix DNA was prepared.

    time (min) temperature (°C) function
    3:00 98 melting
    0:30 98 melting
    0:30 52 annealing
    1:00 72 extension
    10:00 72 extension
    forever 12 storage


    Concentrations measured with a Nanodrop:
      PCR purification using QIAGEN kit
    • Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down
    • Transfer in a centrifugation column
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Add 700μL of washing solution
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Add 500μL of washing solution
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Put the column in a sterile 1.5mL microcentrifuge tube
    • Add 45μL of DNAse/RNAse free water on the membrane
    • Wait 2 minutes
    • Centrifuge 2min at 10000rpm
    • Discard the column, DNA is saved in water
    [PCR product with gBlock] (ng/μL) [PCR product without gBlock] (ng/μL)
    RibA 3.5 3.4
    RibD 6.4 3.3
    RibE 5.0 3.7
    RibT25 3.5 3.8
    RibT48 8.7 3.3