Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"

• HOME
• TEAM
• PROJECT
  • Description
  • Experiments & Protocols
  • Results
  • Design
• PARTS
  • Team Parts
  • Basic Parts
  • Composite Parts
  • Part Collection
• NOTEBOOK
  • Vitamin A
  • Vitamin B2
  • Vitamin B12
  • Manufacturing
  • Riboswitch
• ATTRIBUTIONS
• COLLABORATIONS
• HUMAN PRACTICES
• SAFETY
• MODELING
• MEASUREMENT
• SOFTWARE
• ENTREPRENEURSHIP

13/07

• Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.
Dilution in water and PCR amplification, using the following protocol:
• 1 μL gBlock (0.1 to 1ng)
• 1 μL forward primer (10 μM)
• 1 μL reverse primer (10 μM)
• 22 μL DNAse/RNAse free water
• 25 μL LifeTech MasterMix (2X)

RibA + o15.001 (GCGCCCGAAGACTTATGCAG) + o15.002(GGCCCCGCGCATATGAAG)
RibD + o15.003(CGCTATAGAAGACTTGAGAAGATCTG) + o15.004(GCGCGGCACCACATATGAAG)
RibE + o15.005(CGGCTATAGAAGACTTGCGC) + o15.006(CGCGCCGGCATATGAAGA)
RibT25 + o15.007(CCGCGTATAGAAGACTGCTAGA) + o15.008(CAGCAGCATATGAAGACAACCC)
RibT48 + o15.009(GCGGTATAGAAGACTGCTAGAGA) + o15.010(CAGCAGCATATGAAGACAACCC)

For each PCR reaction, a negative control without matrix DNA was prepared.


12 cycles amplification, using the following parameters:

time (min)	temperature (°C)	function
3:00	98	melting
0:30	98	melting
0:30	52	annealing
1:00	72	extension
10:00	72	extension
forever	12	storage

PCR purification using QIAGEN kit

PCR purification protocol Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down Transfer in a centrifugation column Centrifuge 1 min at 14000 rpm Throw the filtration product Add 700μL of washing solution Centrifuge 1 min at 14000 rpm Throw the filtration product Add 500μL of washing solution Centrifuge 1 min at 14000 rpm Throw the filtration product Centrifuge 1 min at 14000 rpm Throw the filtration product Put the column in a sterile 1.5mL microcentrifuge tube Add 45μL of DNAse/RNAse free water on the membrane Wait 2 minutes Centrifuge 2min at 10000rpm Discard the column, DNA is saved in water

Concentrations measured with a Nanodrop:

	[PCR product with gBlock] (ng/μL)	[PCR product without gBlock] (ng/μL)
RibA	3.5	3.4
RibD	6.4	3.3
RibE	5.0	3.7
RibT25	3.5	3.8
RibT48	8.7	3.3

Almost no difference between the PCR and their corresponding negative control.
It could be the fallout of the limited number of cycles. (We only used 12 cycles, as advised by IDT)
NEB Tm calculator gave really different Tm for the PCR primers than Geneious and IDT.
We decided to launch two PCR, both with 35 cycles, but with two different annealing
temperature: 52 and 64°C.

14/07
Launched the two different PCR with different Tm.

PCR with high annealing temperature, 35 cycles:

time (min)	temperature (°C)	function
3:00	98	melting
0:30	98	melting
0:30	64	annealing
1:00	72	extension
10:00	72	extension
forever	12	storage

PCR with low annealing temperature, 35 cycles:

time (min)	temperature (°C)	function
3:00	98	melting
0:30	98	melting
0:30	64	annealing
1:00	72	extension
10:00	72	extension
forever	12	storage

After PCR, we ran the PCR products on a TAE - 1% agarose gel (100V, 20min) to check
if the amplification product correspond to the expected size of the gBlocks.

From left to right: 1kb Ladder, RibA, D, E, T25 and T48 amplified at 52°C and Rib A, D, E, T25 and T48 amplified at 64°C

The bands are not really specific and seems to be smeared over the gel.
However, we can see that the extremity of each band correspond approximatively
to the expected size of our parts, except RibD amplified at 64°C for which no band has been detected. We purified our PCR product according to the previously used protocol,
and then measure the DNA concentration using a Nanodrop.

Part Name	PCR product amplified at 52°C concentration (ng/μL)	PCR product amplified at 64°C concentration (ng/μL)
RibA	54.3	132.7
RibD	50.5	140.2
RibE	67.1	78.2
RibT25	63.6	136.0
RibT48	61.2	143.1

16/07
Annealing of o15.011 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAT) and o15.012 (CTAGATCCCCCAAGTCTTCGAAGACAAGCATGG) using the following protocol:

Annealing Protocol Phosphorylation of the oligos 5.6μL DNAse/RNAse free water 6.0μL o15.011 (10µM) 6.0μL o15.012 (10µM) 2.0μL 10X T4 DNA ligase buffer 0.4μL T4 PolyNucleotide Kinase Total: 20μL incube 30min at 37°C add 1μL of 1M NaCl incube 5min at 95°C let the mix cool down use 2μL of the mix as a 10X solution

Inoculate LB + erythromycin (150ng/μL) with g15.21 containing pKV6.
Inoculate M17 + erythromycin (10ng/μL) with g15.13 containing pSIP411.
17/07
Miniprep of g15.13 and g15.21 as describe below:

Miniprep protocol using a QIAGEN kit centrifuge an overnight culture of cells 10min at 4krpm throw the filtrate resuspend the pellet in 250μL of Cell Resuspension Solution then mix it transfer it in a 1.5mL microcentrifuge tube add 250mL of Cell lysis solution and mix by inverting several times incube until the liquid is clear, maximum 5min add 10μL of Alkalyne protease solution, mix by inverting several times and incube 3 to 4 min add 350μL of Neutralisation Solution and mix by inverting several times centrifuge 10min at 14krpm add the supernatant in a column centrifuge 1min, 14krpm, then throw the filtrat add 750μL Washing Solution centrifuge 1min, 14krpm, then throw the filtrat add 250μL Washing Solution centrifuge 2min, 14krpm, then throw the filtrat centrifuge 1min, 14krpm transfer the column in a sterile microcentrifuge 1.5ml tube add 50μL of DNAse/RNAse free water right on the membrane of the filter, wait 1min centrifuge 1min, 14krpm throw the column, plasmid is saved in water

As g15.13 is a gram positive bacteria, we added IDK what quantity of lysozyme IDK when Measurement of DNA concentration