Team:EPF Lausanne/Notebook/Ecoli

EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits

E. Coli Laboratory Notebook

Construction of pdCas9-w

pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP.

Materials and method

  • Open pdCas9-bacteria by PCR. pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).
    • Miniprep (cf. Protocols) bacteria containing pdCas9-bacteria
    • 20 µL Phusion PCR (cf. Protocols) of pdCas9-bacteria with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols)
    • Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler ladder)
  • Extract w subunit from pWJ66 by PCR. pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
    • Miniprep (cf. Protocols) bacteria containing pWJ66
    • 20 µL Phusion PCR (cf. Protocols) of pWJ66 using primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols)
    • Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)
  • Gibson assembly of pdCas9-w
    • Gibson assembly (cf. Protocols) with purified PCR products of pdCas9-bacteria and w subunit
    • Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product
    • Colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)
    • Miniprep (cf. Protocols) of overnight liquid cultures to isolate pdCas9-w
    • Restriction digest (Cf. Protocols) of pdCas9-w with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products (with 1kb Generuler)
    • Sequencing (Microsynth)
  • Site-directed mutagenesis of dCas9-w (necesary for pdCas9-w to be BioBrick compatible)
    • Site-directed mutagenesis (cf. Protocols) of pdCas9-w with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w
    • Miniprep (cf. Protocols) of overnight liquid cultures in 7 mL LB with Chloramphenicol of colonies from site-directed mutagenesis plate to isolate mutated pdCas9-w plasmids
    • Restriction digest (cf. Protocols) of mutated pdCas9-w plasmids with EcoRI to identify colonies for which the mutagenesis was successful
    • Sequencing (Microsynth) of one pdCas9-w for which the mutageneis worked according to the restriction digest
  • BioBrick mutated dCas9-w

Results

Open pdCas9 by PCR

Linearized pdCas9-w is expected to be 6705 bp.
We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. Many, but not all, of our samples were successfully amplified (cf. Fig.1).
For next steps, sample from lane 1 (cf. Fig.1) was used.

Figure 1
Fig.1 - Gel of linearized pdCas9

Extract w subunit from pWJ66 by PCR

Successful PCR reactions are expected to yield 340 bp fragments.
PCR was succesful for sample visible on gel. (cf. Fig.2)

Figure 2
Fig.2 - Gel of w subunit extracted from pWJ66

Gibson assembly of pdCas9-w

Colony PCR

Amplicons are 666 bp if Gibson assembly worked and 396 bp if the plasmid self-ligated.
Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.
Gibson assembly seems to have worked for some samples. (cf. Fig.3)
To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.

Figure 3a Figure 3b Figure 3c Figure 3d
Fig.3 - Gels of colony PCR of dCas9-w Gibson assembly products

Restriction digest

pdCas9-w samples from different colonies are present on gels in triplicates in the following order:

  • Undigested - expected to yield 7 kb circular plasmid (migrates faster than linear fragments of the same size)
  • Digested by BamHI - expected to yield two fragments of 6147 bp and 834 bp if insert is present or one 6705 bp fragment if it is not
  • Digested by KpnI - expected to yield two fragments of 45334 bp and 2447 bp if insert is present or one 6705 bp fragment if it is not

BamHI and KpnI are both unique cutters in pdCas9 (without the insert) and double cutters in pdCas9-w (with the insert).
Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see.
By looking at the relative heights, we can say that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel.
Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).

Figure 4a Figure 4b Figure 4c
Fig.4 - Gels of restriction digest of pdCas9-w Gibson assembly products

Sequencing

As dCas9-w is very long, only part of it was sequenced (the w subunit and its surrounding base pairs). No mutations were detected.

Site-directed mutagenesis of dCas9-w

BioBrick mutated dCas9-w

Construction of pdCas9-w-sgRNAs

These experiments consist of inserting one or two sgRNA producing cassettes (cf. Fig.8a) into pdCas9-w.
pdCas9-w was linearized by restriction digest. The sgRNA cassettes were synthesized (IDT) and necessary overlaps were added by PCR. The sgRNAs were inserted into pdCas9-w by Gibson assembly.

The sgRNA cassettes were synthesized with sequences "A" and "B" at its ends (cf. Fig.8a). These are the sequences those found at the ends of the linearized pdCas9-w.
When one cassette is inserted, no overlaps need to be added.
When two or three cassettes are added, sequences "C" and/or "D" need to be added at the ends of the cassettes (cf. Fig.8b), thus obtaining unique overlaps for the Gibson assembly.

Figure ¨8a Figure ¨8b
Fig.8:Schematics of structure and assembly of sgRNA cassettes
Fig.8a - Structure of a sgRNA cassette
Fig.8b - Assembly of three sgRNA cassettes

Materials and method

  • Open pdCas9-w by restriction digest
    • Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Chloramphenicol of pdCas9-w containing bacteria
    • Restriction digest (Cf. Protocols) of pdCas9-w with BsrBI (blunt ends)
    • Agarose gel electrophoresis of 2 µL of digested and undigested product (with 1kb Generuler)
  • Amplify sgRNA cassettes by PCR
    • 20 µL Phusion or Q5 PCR (cf. Protocols) of sgRNA cassette with primers as indicated in table below (->Results->Amplify sgRNA cassettes by PCR)
    • Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)
    • PCR product purification (cf. Protocols)
  • Assemble pdCas9-w-sgRNA constructs by Gibson assembly
    • Part 1: pdCas9-w + sgRNA assembly
      • Gibson assembly (cf. Protocols) with linearized pdCas9-w and purified sgRNA PCR products:
      • Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product, spreading on Chloramphenicol plates
      • Colony PCR (cf. Protocols) of colonies from plate used for culture of transformed cells with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler)
        One colony PCR (cf. Fig11a) was done with primers f_Gbs_pdCas9 and r_Scq_pdCas9_w_sgRNA
      • Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Chloramphenicol of colonies from plate used for culture of transformed cells to isolate pdCas9-w plasmids
      • Sequencing (Microsynth) of one colony for which Gibson assembly worked according to colony PCR and restriction analysis
    • Part 2: pdCas9-w-sgRNA + sgRNA assembly

Results

Open pdCas9-w by restriction digest

The digested and undigested plasmids should have the same size. Circular fragments migrates faster than linear fragments of the same size. This means that the undigested plasmid should migrate faster than the digested plasmid.
Even though the ladder is not clear, by looking at the relative heights we can see that the digested sample migrated more slowly than the undigested sample (cf. Fig.9). The restriction digest was successful.

Note that this was repeated several times since we needed a lot of linearized pdCas9-w.

Figure 9
Fig.9 - Gel of digested pdCas9-w (lane 1) and undigested pdCas9-w (lane 2)

Amplify sgRNA cassettes by PCR

sgRNA cassette(s) Forward primer(s) / Reverse primer(s)
Z0 f_Gbs_sgRNA-A / r_Gbs_sgRNA-B
f_Gbs_sgRNA-A / r_Gbs_sgRNA-BtoD
Z4 f_Gbs_sgRNA-A / r_Gbs_sgRNA-B
Z35 f_Gbs_sgRNA-A / r_Gbs_sgRNA-B
X0 f_Gbs_sgRNA-A / r_Gbs_sgRNA-B
X4 f_Gbs_sgRNA-A / r_Gbs_sgRNA-B
X35 f_Gbs_sgRNA-A / r_Gbs_sgRNA-B

All amplified sgRNA cassettes are expected to be about 370 bp.

sgRNA cassette Z0 was amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).

sgRNA cassette Z4 was amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).

sgRNA cassette Z35 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)

sgRNA cassette X0 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10d)

sgRNA cassette X4 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10e)

sgRNA cassette X35 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10f)

Figure 10a Figure 10b Figure 10c Figure 10d Figure 10e Figure 10f
Fig.10: Gels of sgRNA cassettes amplified by PCR
Fig.10a - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)
Fig.10b - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B
Fig.10c - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B
Fig.10d - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B
Fig.10e - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B
Fig.10f - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B

Assemble pdCas9-w-sgRNA constructs by Gibson assembly

Part 1: pdCas9-w + sgRNA assembly

In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.

pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.11a) was confirmed by sequencing to be pdCas9-w-Z0 and to not contain any mutations that may have an effect on its activity. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.11a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. (This sample will be used again in Part 2.)
Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.11b). Sequencing comfirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.11c) and sequencing confirmed that is the case. Sequencing also showed some mutations or deletions in the promoter and/or terminator for these 2 samples. We decided to keep working with these and test whether these mutations are significative with an activity assay.
Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.11d). However, it contains a mutation in the promoter. A 2nd pdCas9-w-X0 without mutations will be constructed in part 2, after which we will be able to compare the activity of this promoter with/without a mutation.
Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.11e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4 and that it does not contain any mutations.
Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.11d) and no mutations were found in the sequence.

Figure 11a Figure 11b Figure 11c Figure 11d Figure 11e
Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products
Fig.11a - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.
Fig.11b - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies
Fig.11c - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others
Fig.11d - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.
Fig.11e - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.

Part 2: pdCas9-w-sgRNA + sgRNA assembly

Construction of pWJ89alt

pWJ89alt was constructed from the following DNA fragments:

  • pWJ89: low copy plasmid with GFP under a J23117 promoter with and GG-rich upstream regulating sequence (URS) and a Kanamycin resistance gene, received from David Bikard's lab
  • J23117alt: alternative promoter with randomly generated sequences except for the -35 and -10 sequences (synthesized by IDT)

pWJ89 was amplified without its J23117 promoter by PCR and the J23117alt promoter was amplified by PCR. These fragments were assembled by Gibson assembly, the final product is pWj89alt.
The J23117alt promoter was BioBricked.

PCR pWJ89

We received plasmid pWJ89 in bacteria and did a Miniprep (cf. Protocols) on overnight cultures to isolate it. This step consists of amplifying pWJ89 without the J23117 promoter by PCR.

Materials and method

  • 20 µL Phusion PCR and 25 µL Q5 PCR (cf. Protocols) of pWJ89 using primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89.
  • Agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)
  • PCR product purification (cf. Protocols)

Results

Successful PCR reactions are expected to yield 4400 bp amplicons.
Both negative control lanes (cf. Fig.13) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.13). We will work with this sample for next steps.

Figure 13
Fig.13 - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control

PCR J23117alt promoter

This step consists of amplifying J23117alt promoter by primer extension PCR to use it for a Gibson assembly in a further step.

Materials and method

  • 20 µL Phusion PCR and 25 µL Q5 PCR (cf. Protocols) of J23117alt using primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT.
  • Agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)
  • PCR product purification (cf. Protocols)

Results

Successful PCR reactions are expected to yield 340 bp amplicons.
Both negative control lanes (cf. Fig.14) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.

Figure 13
Fig.14 - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control

Gibson assembly of pWJ89alt

This step consists of using Gibson assembly to insert the J23117alt promoter into pWJ89alt from which its original promoter J23117 was extracted by PCR. We transformed cells with the Gibson assembly product and tested for colonies that contain the construct by colony PCR, restriction digest and sequencing.

Materials and method

  • Gibson assembly (cf. Protocols) with purified PCR products:
    • Amplified pWJ89 (wihtout J23117): 0.05 pmol = 143 ng
    • J23117alt promoter: 0.1 pmol = 22.1 ng
  • Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product, spreading on Kanamycin plates
  • Colony PCR (cf. Protocols) of colonies from plate used for culture of transformed cells with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler)
  • Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Kanamycin and sequencing (Microsynth) of one colony for which Gibson assembly worked according to colony PCR

Results

Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.
Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).

BioBrick J23117alt promoter

Coming soon

Construction of pWJ89_mCherry

Coming soon

Open pWJ89 by restriction digest

Coming soon

PCR pWJ89alt

Coming soon

Extract mCherry by restriction digest

Coming soon

PCR mCherry

Coming soon

Gibson assembly of pWJ89_mCherry

Coming soon

Transistor activity assay

Coming soon

Primer table

Name Sequence Associated part
f_Gbs_pdCas9 CTCGAGTAAGGATCTCCAG pdCas9
f_Gbs_sgRNA-CtoA GTCGGCGATGGTGGTAGCTAATTATGTTCCctcgctcactgactcgctac sgRNA cassettes
f_Gbs_sgRNA-DtoA CTAGACCTAACTGAGATACTGTCATAGACGctcgctcactgactcgctac sgRNA cassettes
f_Gbs_sgRNA-A ctcgctcactgactcgctac sgRNA cassettes
f_Gbs_w ACACGCATTGATTTGAGTCA pWJ66
f_Mt_A2080C_pdCas9-w TGACTTTTCGcATTCCTTATTATGTTG pdCas9-w
r_Gbs_pdCas9 GTCACCTCCTAGCTGACTC pdCas9
r_Gbs_sgRNA-B tggcatcttccaggaaatc sgRNA cassettes/td>
r_Gbs_sgRNA-BtoC GGAACATAATTAGCTACCACCATCGCCGACtggcatcttccaggaaatc sgRNA cassettes
r_Gbs_sgRNA-BtoD CGTCTATGACAGTATCTCAGTTAGGTCTAGtggcatcttccaggaaatc sgRNA cassettes/td>
r_Gbs_w atttgatgcctggagatccttactcgagTTAACGACGACCTTCAGCA pWJ66
r_Mt_A2080C_pdCas9-w AGATTTTTTCAATCTTCTCACG pdCas9-w
r_Scq_pdCas9_w_sgRNA ctgatttgagcgtcagat pdCas9-w-sgRNA
EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits

NOT PROOFREAD