Week 8 (12/7 - 18/7)
▪ July 12
Invasin + Listerolysin
☀ Adrian ☀
Prepared restreak of inv/hly plasmid from original stab culture
|
▪ July 13
Anaerobic Promoter
☀ Yi Han & Yun Ting ☀
Ligation for FNRgfp (4X)
200ng of gfp plasmid (4.36ul)
297.5 ng insert (7:1) 10.3
1ul 10Buffer (53.34)
4ul T4 ligase
Trial run of anaerobe chamber
open sachet to decrease O2 at 3.30pm
takes 2.5h to activate
streak plate of P. putida a strict aerobe and E. coli, facultative aerobe in chamber at 30deg C to grow O/N
P. putida is an obligate aerobe and if chamber works ,it will not grow
E. coli should grow in both conditions
controls grown outside chamber
|
▪ July 14
Anaerobic Promoter
Invasin + Listerolysin
☀ Yi Han ☀
No colonies for FNRgfp plasmid
| Inv Plasmid Verification |
| buffer | 1 |
| EcoRI | 0.5 |
| in plasmid | 0.5 |
| dH2O | 8 |
| Total | 10ul |
Gel extraction RE digest of EsaR-GFP plasmid
| Ligation | Control |
| Vector (45ng) | 1 | 1 |
| insert | 1 | 1 |
| Buffer | 1 | 1 |
| dH2O | 6 | 7 |
| ligase | 1 | 1 |
Transformation of FNRgfp
Anaerobe jar
E. coli grew in both conditions
P putida-> some growth in anaerobe chamber
Proper streak plate in aerobic conditions
Packet runs out after 16 hours
Invasin + Listerolysin
☀ Yan Ting & Yun Ting ☀
Colony PCR of invasin
▶ Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.
▶ Also constituted dNTP w 2.5mM of each atcg triphosphate.
Anaerobic Promoter
☀ Yi Han & Chi Yan ☀
Transformation of ligated FNRgfp plasmid into dH5alpha
Cleaned waterbath, de-iced the fridge. Today, we also did a spring cleaning for the lab
esa Quorum Sensing
☀ Clarice ☀
Transformation of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)
plate O/N
|
▪ July 15
Anaerobic Promoter
☀ Yi Han ☀
FNRgfp-> no colonies after transformation
| religation (4X reaction) |
| 200ng of gfp plasmid (4.4ul) |
| 2125ng of insert (8ul) |
| 4ul T4 ligase |
| 55.6 H2O |
Anaerobic Promoter
☀ Yi Han & Chi Yan ☀
Transformation of FNR gfp into 20ul of BL21
Invasin + Listerolysin
☀ Yun Ting ☀
10am : Placed BBa_K299812 plate in incubator for overnight growth.
3pm : 100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.
Invasin + Listerolysin
☀ Yan Ting ☀
RE digest of the miniprepped inv/hly plasmid with EcoRI/PstI from (20/7)
▶ Tube C-> 226ng/ul
▶Tube D-> 298ng/ul
| Buffer | 3ul |
| Plasmid | 4ul each |
| EcoRI | 1ul |
| PstI | 1ul |
| H2O | 21ul each |
| Total | 30ul |
▶ incubated at 37degC for 2h
▶ Add 6X loading dye to stop reaction in both tubes
▶ Ran gel (1kb, 100bp, cut vector C, D)
|
▪ July 16
Anaerobic Promoter
☀ Yi Han ☀
No colonies grew
Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder
▶ Seems to be band shift.
Invasin + Listerolysin
☀ Yan Ting & Yun Ting ☀
Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.
Primer conc=0.5 uM, template DNA dissolved in 10ul h20.
Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.
100V for 34min. Tubes 1-2: FP-prefix, RP-suffix. 3-4: FP-VF2, RP-VR. 5-6: FP-prefix, RP_Inv_M2. 7-8: RP-suffix, FP_Inv_M1. No template control with FP-prefix, RP-suffix.
[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].
Gel image saved as “7.17_inv colony.sgd”
Results:
▶ Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.
▶ Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time). Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.
▶ No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.
|
▪ July 17
Anaerobic Promoter
☀ Chi Yan ☀
RE digest of FNR-GFP fusion PCR with EcoRI and PstI
| EcoRI | 1 |
| PstI | 1 |
| Buffer | 5 |
| FNR-GFP from 12/7 in RIP box | 1ug -> 2.5ul |
| H2O | 40.5 |
| Total | 50 |
▶ RE for 2 hours at 37 degrees
▶ Direct purification using Promega kit
Overnight ligation (4X reaction)
| 200ng of gfp plasmid (4.4ul) |
| 400ng of insert (5:1) (4ul) |
| 4ul T4 ligase |
| 8ul T4 ligase buffer |
| 44.1 H2O |
ESA Quorum Sensing
☀ Adrian ☀
Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)
| 10x T4 DNA ligase Buffer | 1ul |
| Vector | 1ul |
| Insert | 5ul |
| H2O | 10ul |
| T4 DNA ligase | 1ul |
▶ Reactions were incubated for 30min at room temperature
Transformation
pSB1A2 esaRBSGFP
pSB1A2 RNG GFP
Control cut pSB1A2
Anaerobic Promoter
☀ Yi Han ☀
For plates on LB alone there was a lawn
For pUC19, the transformation worked, and separated colonies were produced
No colonies were produced for the FNR-gfp plasmid
|
▪ July 18
Anaerobic Promoter
☀ Xin Yi ☀
Transformation of FNRGFP ligated product into BL21 (from Chi Yan 17/7)
1. 3ul pUC19 control +10ul BL21
2. 20ul Ligation product + 20ul BL21
3. 5ul Ligation product + 20ul BL21
Plated on LB+amp plates
40ul of transformed bacteria in SOC media on LB+amp
20ul of transformed bacteria in SOC media on LB alone
esa Quorum Sensing
☀ Adrian ☀
Confirmation of gfp plasmid
RE digest of gfp plasmid with EcoRI/PStI
| EcoRI | 2ul |
| PstI | 2ul |
| Buffer | 4ul |
| DNA | 10ul |
| H2O | 22ul |
| Total | 40ul |
Ran gel, band size was correct
gel extraction -> 101ng/ul
Master plates
RNG - 4 colonies
esaRGFP- 6 colonies
esa Quorum Sensing
☀ Adrian ☀
Vector dimer check
8 colonies were selected from the control plate (26/7)
| PCR mastermix |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul 1ug |
| FP_Biobricks_Prefix | 16ul |
| RP_Biobricks_Prefix | 16ul |
| GoTaq | 2ul |
| Total | 400ul |
The control plate had plasmids with a 800bp insert
Gel extract was performed on a 2kb band
Ligation Troubleshooting
| Ligation Mastermix |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| FP_Biobricks_Suffix | 16ul |
| RP_Biobricks_Suffix | 16ul |
| GoTaq | 2ul |
| Total | 400ul |
Colony PCR
8 colonies were selected from esaR and RNG each, total 16 colonies
| PCR Mastermix |
| H2O | 444ul |
| Buffer | 160ul |
| MgCl2 | 64ul |
| dNTP | 64ul |
| FP_Biobricks_Suffix | 32ul |
| RP_Biobricks_Suffix | 32ul |
| GoTaq | 4ul |
| Total | 800ul |
Ran gel
Lanes
1. Vector Backbone (EcoRI/PstI
2. Control Ligation mix
3. esaR ligation mix
4. RNG ligation mix
5. T4 Ligation buffer
6. Blank
|
|
