Team:UCSC/Protocols
Protocols
A compilation of the protocols used at UCSC: from Gibson to MGM.
To view our Notebook click here
Preparing DNA and Running in Gel Electrophoresis
Reagents:
- 10X TBE Buffer
- Deionized Water
- Agarose Powder
- Gel Loading Dye Purple 6X spiked with SYBRGold
- DNA solutions
- DNA Ladder
Equipment:
- Gel Doc-it UV imaging machine (Purple and grey with green tape)
- Computer with Launch VisionWorksLS program open
- Gel electrophoresis Box (with non-morphed electrodes) and Lid
- Power Supply box
- Microwave
- Rotation Mixer
- Weight
Methods:
- Protocol 1: Preparing the Gel
- Create 500 mL of 1X TBE buffer by mixing 50 mL of 10X TBE buffer and 450 mL of deionized H20
- For a 1% (w/v) gel (for very large DNA), take 50 mL of 1X TBE buffer and mix with the appropriate percent mass of Agarose powder (Weigh out 0.5 g for a 1% gel)
- Mix thoroughly using the rotation mixer (optional)
- Loosely plug flask with paper towel and heat in microwave for approximately 1 minute, or until the agarose is fully dissolved. The liquid should be completely clear.
- Once completed, wait till the beaker cools and prepare to add solution to the gel tray. Put comb into the tray and make sure that the tray is oriented in the gel box so that its ends are blocked against the sides of the box.
- SLOWLY pour solution into gel tray to avoid creating bubbles.
- Allow gel to solidify and cool for 20 - 30 minutes or until fully solidified. This can be tested by how easy it is to move the pick.
- Once solidified, gently turn the gel tray with the gel so that the ends are exposed.
- Fill the gel box with 1X TBE buffer until gel is fully covered (0.5 - 1 cm above gel)
- Slowly and carefully remove the comb so as not to tear the wells.
- Protocol 2: Staining the DNA Samples and Running Gel
Caution: Gel box has high voltage! Be sure to turn off power pack and unplug leads before removing lid of gel box.
- You will be staining the DNA using Professor Bernick’s Droplet Technique. Depending on how many samples you have (including controls and DNA ladder), place 1 uL droplets of 6X Loading Dye on a piece of parafilm.
- Take 5 uL of each DNA sample and add to an individual droplet. You will have a final volume of 6uL. Be sure to mix thoroughly up and down, then take the sample and inject into a well.
- Make sure to change pipet tips for each DNA sample so as to prevent contamination! Keep track of the positions of each sample
- Once all samples have been loaded, close the gel box and attach all electrodes to the gel box and to the power pack. (Use color coding to be sure all electrodes are attached correctly. Black = negative electrode and Red = positive. The electrode closest to the samples will be negative while the further is positive.
- Turn on the power pack and set to 120 V. You should immediately see bubbles rising from the wires in the gel box.
- Run continuously for 75 minutes. Once complete, turn of the power pack.
- Protocol 3: Visualizing the Gel
- Remove the lid from the gel box (Be sure that the power pack is turned off!)
- Pour out the 1x TBE buffer into the used TBE buffer beaker
- Open the Gel Doc it door and pull out the UV transilluminator. (Make sure it is off!)
- Transfer the gel to the UV transilluminator tray, push it back into the machine and flip the on switch on the lower right corner.
- Close the door and make sure the knob is turned to Syber Gold. Go to the computer and open the Launch VisionWorks program.
- Flick the UV light switch and press preview on the computer. When the gel is clearly visible and you can see the bands, press capture and save it to the folder IGEM2015.
References:
Ruben, Giulia, “Lab 2 Protocol #1, Gel Electrophoresis”, Biochemistry Laboratory, Winter 2015
Colony PCR Protocol for Transformed E. coli
Equipment
- Thermocycler
- Micro-pipettes (P10, P20 & P1000)
- Thin-walled PCR Tubes
- Eppendorf tubes
- Microcentrifuge with PCR and Eppendorf tube adapters
- Ice bucket and ice (Ice is found in the Autoclave room 202)
Reagents
- Fresh Miliq water (Found in the Autoclave room 202)
- SOC Media
- Titaq 2x Master Mix
Methods
After plating your electroporated E. coli cells, choose about 6 large cultures with the least amount of micro satellites.
Take a micropipet tip and gently touch it to the colony (No need to scrape as this will be too many cells)
Place the micropipet into an eppendorf tube with 10 uL of water to create a 1:10 dilution of DNA, and slowly pipet up and down to lyse the cells.
Take 1uL of this dilution and use it as DNA template for your PCR reaction
- Plasmid Specific Primer Options
- Breakdown Primers:
- bGlu_Seq_Fw1: 5’ CCCTCGATTTTCCGCCTGCCGATTA 3’
- bGlu_Seq_Rv4: 5’ GCGCTCTAGAACTAGTGGATCCCCC 3’
- Dominic Primers:
- Aldy5Seq1F: 5’-TACTTCACATTCGCGGACCTATTG - 3’
- Aldy5Seq5R: 5’-AGAACTAGTGGATCCCCCG - 3’
- Professor Bernick Primers:
- PCR Ingredients
|
Components |
25 uL Reaction |
|
Titaq 2x Master Mix |
12.5 uL |
|
Forward Primer |
0.5 uL |
|
Reverse Primer |
0.5 uL |
|
Template DNA |
1 uL |
|
PCR Enhancer |
5 uL |
|
Miliq Water |
5.5 uL |
References
Professor David Bernick, Lab Advisor
Polymerase Chain Reaction (PCR) for Amplification of pTA963 Expression Plasmids
Equipment:
- Heat block or thermo-cycler
- Micro-pipettes (P10 & P20)
- Thin-walled PCR Tubes
- Microcentrifuge with PCR adapters
- Small beaker and ice (Ice is found in the Autoclave room 202)
Methods
We will be amplifying two versions of the pTA963 expression plasmid: One which allows the insertions of a 6 x Histidine Tag on the N-Terminus region, and other which allows insertion in the C- Terminus region.
You will be using different primers depending on which plasmid you are amplifying, so be sure to grab the right ones!
If you have the N-Terminal, the primers you will be using are:
pTA963Nterm Forward
pTA963Nterm Reverse
If you have the C-Terminal, the primers you will be using are:
pTA963Cterm Forward:
CGATAAGCTTGATATCGAATTCCTG
pTA963Cterm Reverse:
ATGCGCAATAGGTCCGCG
Before you begin, always prepare the thermocycler using the conditions below. The thermocycler takes time to warm up, so run the appropriate protocol as you are mixing so that you can place the PCR reaction in the machine as soon as possible.
In this experiment, you will be preparing the thermocycler for a Touchdown PCR. The annealing temperature for the first round of cycles will decrease by 0.2°C each cycle for a total temperature drop of 1°C/5 cycles. Use the appropriate parameters below depending on which reaction you are running.
|
C-terminal cycles (15 cycles, 10 cycles) |
||||||||
|
|<------- |
--------- |
x 15 | |
|<------- |
--------- |
-- x 10| |
|||
|
98°C |
98°C |
66°C* |
72°C |
98°C |
63°C |
72°C |
72°C |
4°C |
|
5:00 |
0:10 |
0:10 |
3:00 |
0:10 |
0:10 |
3:00 |
5:00 |
Hold |
*Touchdown is a -0.2 degree per cycle for a total of 3 degree decrease.
|
N-terminal cycles (10 cycles, 15 cycles) |
||||||||
|
|<------- |
--------- |
-- x 10| |
|<------- |
--------- |
x 5 | |
|||
|
98°C |
98°C |
64°C* |
72°C |
98°C |
62°C |
72°C |
72°C |
4°C |
|
5:00 |
0:10 |
0:10 |
3:00 |
0:10 |
0:10 |
3:00 |
5:00 |
Hold |
*Touchdown is -0.2 degrees per cycle for a total of 2 degree decrease
Use the following protocol if 2X Q5 Mastermix is not available :
|
COMPONENTS |
25 µL RXN |
50 µL RXN |
FINAL |
|
5X Q5 Reaction Buffer |
5µL |
10 µL |
1X |
|
10 mM dNTPS |
0.5 µL |
1 µL |
200 µM |
|
10 uM Forward Primer |
1.25 µL |
2.5 µL |
0.5 µM |
|
10 uM Reverse Primer |
1.25 µL |
2.5 µL |
0.5 µM |
|
Template DNA |
0.5 uL |
1 uL |
<1,000 ng |
|
Q5 High-Fidelity DNA Polymerase |
0.25 µL |
0.5 µL |
0.02 U/µl |
|
PCR Enhancer (optional) |
(5 µL) |
(10 µL) |
(1X) |
|
Nuclease-Free Water |
11.25 ul |
22.50 |
If Mastermix is available, use the following protocol:
|
COMPONENTS |
25 µL RXN |
50 uL RXN |
|
MiliQ H20 |
4.5 uL |
9 uL |
|
5X PCR Enhancer |
5 uL |
10 uL |
|
10 uM Forward Primer |
1.25 uL |
2.5 uL |
|
10 uM Reverse Primer |
1.25 uL |
2.5 uL |
|
Diluted pTA963 Plasmid |
0.5 uL |
1 uL |
|
2X Q5 MasterMix |
12.5 uL |
25 uL |
Obtain thin-walled PCR tubes – be sure to wear gloves when removing them from the container. Then, distribute the appropriate volume of primers, plasmid and water into the tube. Do not add DNA Polymerase or Mastermix, this will go last and only when you are ready to run the reaction in the thermocycler. Place all reagent and reaction tubes on ice while you wait.
It’s best to start with the appropriate volume of H20, then add all the other reagents.
Mix contents of each tube thoroughly, either by by pipetting up and down slowly, OR placing the tube on a vortex mixer and microcentrifuge for about a second.
Make sure your tube is well labelled with group members, the specific plasmid you are amplifying, and the date.
Clean- Up
Dump ice into the sink and place ice box in designated area on side bench
Place all remaining plasmid and primer samples back in the fridge.
References:
Ruben, Giulia, “Lab 4 Protocol #2, Polymerase Chain Reaction”, Biochemistry Laboratory, Winter 2015
Dominic Schenone, lab advisor
Protocol for Fragment Assembly and Gene Isolation from H. Hispanica
Equipment:
- Heat block
- Thermocycler
- Micro-pipettes (P10, P20 & P1000)
- Thin-walled PCR Tubes
- Eppendorf tubes
- Microcentrifuge with PCR and Eppendorf tube adapters
- Ice bucket and ice (Ice is found in the Autoclave room 202)
- 2 Liter Beaker
Reagents
- Fresh Miliq water (Also found in the Autoclave room 202)
- 23% Modified Growth Medium
Methods
- Fragment Assembly Protocol
Obtain the appropriate amounts of fragment 1, 2 and 3 that provide an equal molar concentration of each fragment. In this case, the concentrations are:
- Fragment 1: 0.88 uL
- Fragment 2: 1.25 uL
- Fragment 3: 1 uL
Use the following primers:
- bGlu_Fw_flag:
5'CCTGCCGATTACTTCACATTCGCGGACC
TATTGCGCATATGGCACATGACACGACTGACG 3'
- bGlu_Rv_flag:
5' TTCGATATCAAGCTTATCGTCAGTGGTG
GTGGTGGTGGTGCGAGCGACCGCGGACCTC 3'
Set the thermocycler to the following conditions:
|
Fragment Assembly cycles (25 cycles) |
|||||
|
|<------------- |
---------------- |
x 25 | |
|||
|
98°C |
98°C |
65°C* |
72°C |
72°C |
4°C |
|
5:00 |
0:10 |
0:10 |
1:00 |
5:00 |
Hold |
- Gene Isolation Protocol
- Growth of Haloarcula Hispanica
Your cells need to be grown in 23% Modified Growth media till they have reached an A 600reading between 0.4 - 0.8.
To make a liter of 23% Modified Growth media, use the following ingredients:
|
Salt Water (30% Stock) |
767 |
|
Pure Water |
200 |
|
Peptone( Oxoid) |
5 |
|
Yeast Extract |
1 |
*Don’t use Difco Bacto-Peptone, as it was reported in 1988 that it contained bile salts that lyse halobacteria.
- Rapid Chromosomal DNA Isolation
Spin down 1 mL of a freshly grown Hbt. salinarum culture at exponential or early stationary
phase (1 minute at max. rpm in a microcentrifuge)
Suck off the supernatant.
Add 400 μL pure water and lyse the cells by gently pipetting. The cells disrupt immediately by
osmotic lysis.
Inactivate the proteins by heating the DNA solution up to 70°C for 10 min.
Comments:
- a) DNA from freshly grown cultures (exponential or early stationary phase) give better results for
further reactions than old ones.
- b) use 1 – 3 μl as a template for amplifying a DNA fragment by PCR.
- c) digest 30 μl (in 100 μl final volume) for southern blot analysis.
- d) if there is a problem using the DNA as template for PCR it could be due to much DNA. Try
several concentrations or volumes e.g. 1, 5, 10 μl from stock solution.
- Nested PCR Part 1: Wild Type Beta Glucosidase Isolation
Use the following primers for the first step of nested PCR:
- bGlu_iso_Fw: 5' CACTGTTTGGGTGCGCCTGTCATG 3'
- bGlu_iso_Rv: 5' GTAGTGGGTATTCGGGGTCCGGTG 3'
Set the thermocycler to the following conditions:
|
Gene Isolation cycles (25 cycles) |
|||||
|
|<------------- |
---------------- |
x 25 | |
|||
|
98°C |
98°C |
71°C* |
72°C |
72°C |
4°C |
|
5:00 |
0:10 |
0:10 |
0:42 sec |
5:00 |
Hold |
- PCR Reaction Ingredients
Use the following protocol if 2X Q5 Mastermix is not available :
|
COMPONENTS |
25 µL RXN |
50 µL RXN |
FINAL |
|
5X Q5 Reaction Buffer |
5µL |
10 µL |
1X |
|
10 mM dNTP |
0.5 µL |
1 µL |
200 µM |
|
10 uM Forward Primer |
1.25 µL |
2.5 µL |
0.5 µM |
|
10 uM Reverse Primer |
1.25 µL |
2.5 µL |
0.5 µM |
|
Template DNA |
0.5 uL |
1 uL |
<1,000 ng |
|
Q5 High-Fidelity DNA Polymerase |
0.25 µL |
0.5 µL |
0.02 U/µl |
|
PCR Enhancer (optional) |
(5 µL) |
(10 µL) |
(1X) |
|
Nuclease-Free Water |
11.25 ul |
22.50 |
If Mastermix is available, use the following protocol:
|
COMPONENTS |
25 µL RXN |
50 uL RXN |
|
MiliQ H20 |
4.5 uL |
9 uL |
|
5X PCR Enhancer |
5 uL |
10 uL |
|
10 uM Forward Primer |
1.25 uL |
2.5 uL |
|
10 uM Reverse Primer |
1.25 uL |
2.5 uL |
|
Diluted pTA963 Plasmid |
0.5 uL |
1 uL |
|
2X Q5 MasterMix |
12.5 uL |
25 uL |
Obtain thin-walled PCR tubes – be sure to wear gloves when removing them from the container. Then, distribute the appropriate volume of primers, plasmid and water into the tube. Do not add DNA Polymerase or Mastermix, this will go last and only when you are ready to run the reaction in the thermocycler. Place all reagent and reaction tubes on ice while you wait.
It’s best to start with the appropriate volume of H20, then add all the other reagents.
Mix contents of each tube thoroughly, either by by pipetting up and down slowly, OR placing the tube on a vortex mixer and microcentrifuge for about a second.
Make sure your tube is well labelled with group members, the specific plasmid you are amplifying, and the date.
Clean- Up
Dump ice into the sink and place ice box in designated area on side bench
Place all remaining plasmid and primer samples back in the fridge.
References:
Ruben, Giulia, 2015 “Lab 4 Protocol #2, Polymerase Chain Reaction”, Biochemistry Laboratory
Dyall-Smith, Mike., Rodriguez-Valera., 2008 “Modified Growth Medium (MGM) for Haloarchea”, The Halohandbook: Protocols for Haloarcheal Genetics (7th ed.). 14-15
Dyall-Smith, Mike., Pfieffer, Matthias., 2008 “Alternative Rapid Chromosomal DNA Isolation”, The Halohandbook: Protocols for Haloarcheal Genetics (7th ed.). 70
Ingredients
- SOB
- 20 mM glucose
Protocol
- Follow directions to make 1 liter of SOB media
- After cooling medium to less than 50°C, add 20 ml filter sterilized 20% glucose solution
Summary
SOB Medium. Used in growing bacteria for preparing chemically competent cells
Ingredients
- 0.5% (w/v) yeast extract
- 2% (w/v) tryptone
- 10 mM NaCl
- 2.5 mM KCl
- 20 mM MgSO4
Per liter:
- 5 g yeast extract
- 20 g tryptone
- 0.584 g NaCl
- 0.186 g KCl
- 2.4 g MgSO4
Note: Some formulations of SOB use 10 mM MgCl2 and 10 mM MgSO4 instead of 20 mM MgSO4.
SOB medium is also available dry premixed from Difco, 0443-17.
Adjust to pH 7.5 prior to use. This requires approximately 25 ml of 1M NaOH per liter.
15/10 medium
Growth of competent TOP10 cells in Example 2 of the Bloom05 patent is performed in 15/10 broth, which is similar to SOB:
- 1.5% yeast extract
- 1% Bacto-Tryptone
- 10mM NaCl
- 2mM KCl
- 10 mM MgCl2
- 10 mM MgSO4
Extended instructions
- 1 M MgCl2 stock: dissolve 20.33 g MgCl2 6H2O in 100 ml ddH2O (XXX), autoclave on liquid cycle @ XXX°C for 20 min (can be done at the same time as SOC pre-mix below)
- 250 mM KCl stock: dissolve 1.86 KCl in 100 ml ddH2O (XXX)
- combine:
|
Reagent |
for 1 L |
500 mL |
100 mL |
|
tryptone |
20 g |
10 g |
2g |
|
yeast |
5g |
2.5 g |
0.5 g |
|
NaCl |
0.5 g |
0.25 g |
0.05 g |
|
250 nM KCl |
10 mL |
5mL |
1 mL |
|
ddH2O |
980 ml |
490 ml |
98 ml |
- adjust pH to 7.0 w/ NaOH
- bring to volume:
|
Reagent |
for 1 L |
500 mL |
100 mL |
- autoclave on liquid cycle @ XXX°C for 20 min
- add autoclaved 1 M MgCl2
|
Reagent |
for 1 L |
500 mL |
100 mL |
|
1 M MgCl2 |
10 ml |
5 ml |
1 ml |
Source
Adapted From:
- Ausubel et al., Short Protocols in Molecular Biology (John Wiley & Sons, ed. 4, 1999) pg. A1-36
Typical Cycling Conditions for Q5 or Phusion
Typical PCR protocol for a 1,000 bp amplicon
|
1 cycle |
98°C |
30 seconds |
|
25 cycles |
98°C |
10 seconds |
|
55°C |
15 seconds |
|
|
72°C |
15 seconds |
|
|
1 cycle |
72°C |
5 minutes (to finish replication on all templates) |
|
1 cycle |
4-10°C |
indefinite period (storing the sample prior to further analysis) |
Polymerase Chain Reaction (PCR) for Fragment Assembly of gblocks
Equipment:
- Heat block or thermo-cycler
- Micro-pipettes (P10 & P20)
- Thin-walled PCR Tubes
- Microcentrifuge with PCR adapters
- Small beaker and ice (Ice is found in the Autoclave room 202)
Methods
We will be amplifying two versions of the gene blocks with a N terminus and C terminus His tag.
You will be using different primers depending on which protein you are creating, so be sure to grab the right ones!
If you have the N-Terminal, the primers you will be using are:
Nterm Forward
atgcaccaccaccaccaccacATGACGGTCACGAACGAG 3'Tm=62.4 3'Ta(annealing temp)=62.1
Nterm Reverse
tatcaagcttatcgacatTCACTTGTCCGAATAGGC 3'Tm=59.1 3'Ta(annealing temp)=62.1
If you have the C-Terminal, the primers you will be using are:
Cterm Forward:
cggacctattgcgcatATGACGGTCACGAACGAG 3'Tm=62.4 3'Ta(annealing temp)=65.4
Cterm Reverse:
tcagtggtggtggtggtggtgCTTGTCCGAATAGGCCGTG 3'Tm=63.7 3'Ta(annealing temp)=65.4
Before you begin, always prepare the thermocycler using the conditions below. The thermocycler takes time to warm up, so run the appropriate protocol as you are mixing so that you can place the PCR reaction in the machine as soon as possible.
In this experiment, you will be preparing the thermocycler for a Touchdown PCR. The annealing temperature for the first round of cycles will decrease by 0.2°C each cycle for a total temperature drop of 1°C/5 cycles. Use the appropriate parameters below depending on which reaction you are running.
|
C-terminal cycles (15 cycles, 10 cycles) |
||||||||
|
|<------- |
--------- |
x 15 | |
|<------- |
--------- |
-- x 10| |
|||
|
98°C |
98°C |
65°C* |
72°C |
98°C |
65°C |
72°C |
72°C |
4°C |
|
5:00 |
0:10 |
0:10 |
1:00 |
0:10 |
0:10 |
1:00 |
5:00 |
Hold |
|
N-terminal cycles (10 cycles, 15 cycles) |
||||||||
|
|<------- |
--------- |
-- x 10| |
|<------- |
--------- |
x 5* | |
|||
|
98°C |
98°C |
62°C* |
72°C |
98°C |
62°C |
72°C |
72°C |
4°C |
|
5:00 |
0:10 |
0:10 |
1:00 |
0:10 |
0:10 |
1:00 |
2:00** |
Hold |
Use the following protocol if 2X Q5 Mastermix is not available :
|
COMPONENTS |
25 µL RXN |
50 µL RXN |
FINAL |
|
5X Q5 Reaction Buffer |
5µL |
10 µL |
1X |
|
10 mM dNTPS |
0.5 µL |
1 µL |
200 µM |
|
10 uM Forward Primer |
1.25 µL |
2.5 µL |
0.5 µM |
|
10 uM Reverse Primer |
1.25 µL |
2.5 µL |
0.5 µM |
|
Template DNA |
0.5 uL |
1 uL |
<1,000 ng |
|
Q5 High-Fidelity DNA Polymerase |
0.25 µL |
0.5 µL |
0.02 U/µl |
|
5X Q5 High GC Enhancer (optional) |
(5 µL) |
(10 µL) |
(1X) |
|
Nuclease-Free Water |
11.75 ul |
23.50 |
If Mastermix is available, use the following protocol:
|
COMPONENTS |
25 µL RXN |
|
MiliQ H20 |
4.5 uL |
|
5X PCR Enhancer |
5 uL |
|
10 uM Forward Primer |
1.25 uL |
|
10 uM Reverse Primer |
1.25 uL |
|
Diluted pTA963 Plasmid |
0.5 uL |
|
2X Q5 MasterMix |
12.5 uL |
For a 50 uL reaction, simply double the above amounts.
Obtain thin-walled PCR tubes – be sure to wear gloves when removing them from the container. Then, distribute the appropriate volume of primers, plasmid and water into the tube. Do not add DNA Polymerase or Mastermix, this will go last and only when you are ready to run the reaction in the thermocycler. Place all reagent and reaction tubes on ice while you wait.
It’s best to start with the appropriate volume of H20, then add all the other reagents.
Mix contents of each tube thoroughly, either by by pipetting up and down slowly, OR placing the tube on a vortex mixer and microcentrifuge for about a second.
Make sure your tube is well labelled with group members, the specific plasmid you are amplifying, and the date.
Clean- Up
Dump ice into the sink and place ice box in designated area on side bench
Place all remaining plasmid and primer samples back in the fridge.
References:
Ruben, Giulia, “Lab 4 Protocol #2, Polymerase Chain Reaction”, Biochemistry Laboratory, Winter 2015
