Team:Carnegie Mellon/Interlab
Interlab Study.
Quantifying the variability of data collection across labs.
Introduction.
As described on the iGEM website, "The goal of the InterLab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world." Part of the purpose of the study is to quantify the variability of data collection across labs and to test the reproducibility of the promoters used. To see our week-by-week notebook, please click here and go to the "Interlab Study" tab.
Overview.
Three plasmids were constructed using parts given to us from the iGEM registry. The first contained a high expressing constitutive J23101 promoter with GFP, while the second one contained a medium expressing constitutive J23106 promoter with GFP, and the third contained a very low-expressing constitutive J23117 promoter with GFP. Diagrams of the three plasmids are shown below.
We constructed these devices by digesting these plasmids: the J23101 promoter, J23106 promoter, J23117 promoter, and E0040 (GFP) with restriction enzymes XbaI and SpeI. We then ligated the GFP fragment into the plasmids containing the promoters. We then transformed these plasmids back into E. coli MACH cells to screen the cells for fluorescence. After identifying the cells containing both the promoter and the GFP, we streaked these colonies out and repeated the selection for cells containing GFP. The DNA from overnight cultures made of these cells was extracted and transformed using the plasmids. We then repeated this for E. coli TOP10 cells which we made ourselves using the iGEM protocol and measured the fluorescence from these samples in both technical and biological replicates using the TECAN to get fluorescence values in RFU (relative fluorescent units).
The protocols we used for this study can be found on the Protocol Page and include MiniPrep, Restriction Enzyme Digest, Agarose Gel Electrophoresis, Gel Extraction, Ligation, and Transformation.
We constructed these devices by digesting these plasmids: the J23101 promoter, J23106 promoter, J23117 promoter, and E0040 (GFP) with restriction enzymes XbaI and SpeI. We then ligated the GFP fragment into the plasmids containing the promoters. We then transformed these plasmids back into E. coli MACH cells to screen the cells for fluorescence. After identifying the cells containing both the promoter and the GFP, we streaked these colonies out and repeated the selection for cells containing GFP. The DNA from overnight cultures made of these cells was extracted and transformed using the plasmids. We then repeated this for E. coli TOP10 cells which we made ourselves using the iGEM protocol and measured the fluorescence from these samples in both technical and biological replicates using the TECAN to get fluorescence values in RFU (relative fluorescent units).
The protocols we used for this study can be found on the Protocol Page and include MiniPrep, Restriction Enzyme Digest, Agarose Gel Electrophoresis, Gel Extraction, Ligation, and Transformation.
Results.
Below are the sequencing data for our devices.
Sequencing Data for Device 1: J23101 + I13504 (B0034-E0040-B0015)
NNNNNNNNNNNNAANNNNNNNNNNNNGGNNTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTC
TGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTA
AAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTG
AAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCG
GTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAA
GAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAG
GTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAA
GAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGG
CGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCC
TTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATANTAATACTAGAGCCAGGCATCAAATAAAANNGAAA
GGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTANANTCACACTGGCTCACCTTCGGGTGGGC
CTTTCTGCGTTTNNATACTANTANNGCCGCTGCAGTCCGCNAAAAGGNAGGTGNNNCNNCCTGNCCTTTTTNCNTNAAANCGAAAANATANT
TCNGTNATNCNNNTNNNCGNNNCTNNANNNNNNNNNNNNGNNNNTNGNNNNGNNNNNNGNNNCNNNNNNNNNNNGNGNNNANCGGTTN
TNNNNNTNNNNNNN
Conclusion: From the TECAN reader results, it was concluded that the intensity of the fluorescence of the cells corresponded with the type of promoter.