Difference between revisions of "Team:HAFS-Korea/Parts"

 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
{{HAFS-Korea}}
 
{{HAFS-Korea}}
 
<html>
 
<html>
 +
<h2>PART</h2><br>
 +
<h4>HAFS-Korea Parts Submissions</h4>
 +
<p>HAFS-Korea has created its own parts by extracting genes from E.coli and T.reesei(which was indeed arduous job than just using the existin gene from offered DNA kits). We conducted our experiment with pET28a vector(kanamicine resistance), but constructed our parts with pSB1C3 vector which has chlorampenicol resistance. Moreover, we ordered different primers for part submissions. For iGEMers, we divided our two genes and cloned in different pSB1CB vector  so that they can use each function of our two different genes.
 +
<img src=https://static.igem.org/mediawiki/2015/5/5e/5_Parts.png width=80%><br><br>
 +
<h2>a. BBa_K1827000/ composite part</h2>
 +
<p>Designed by: Yuree Chung  Group: iGEM15_HAFS-Korea  (2015-09-14)<br>
 +
<h3>E.coli signal-lpp-ompA</h3>
 +
<p>This part consists of the three following genes extracted from E.coli: lpp signal sequence, lpp gene, and ompA gene. The lpp signal sequence allows the lpp and ompA sequence to be expressed successfully. The lpp(lipoprotein) gene that is used in this part consists of the first 9 amino acids of lpp gene, which can still be expressed as proper-functioning lipoprotein. The ompA gene starts from the 46th amino acid to 159th amino acid of the original ompA gene. The whole part is used for creating a specific protein complex called lpp-ompA complex, present in the cellular membrane of E.coli. This complex can attach almost every molecule to the membrane, thereby serving as an effective biotechnological and industrial tool with great potential. The users of this part can insert adequate genes (whether those are from E.coli or from other species) next to this sequence to give E.coli certain function that does not exist in normal E.coli. Thus, they can use this part as a basis to design their own E.coli, suitable for their purpose. As it allows signaling molecules and enzymes to be attached with ease, it has a wide variety of applications, from detection of specific heavy metal to breakdown of macro-molecules. This part, although already used by some people, is meaningful and economical in that it contains only the necessary parts in expressing the protein complex that can be used in various ways by other people. Also, it allows diverse extracellular processes to be carried out without interrupting the inner mechanisms of E.coli, since the complex presents the molecule outside the cell.<br>
 +
<h4>>BBa_K1827000 Part-only sequence (393 bp)</h4>
 +
aaagctactaaactggtactgggcaacaacaatggcccgacccatgaaaacaacaacaatggcccgacccatgaaaaccaactgggcgctggtgcttttg
 +
gtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagc
 +
tcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaa
 +
tccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgt
 +
<h4>Detailed information at Registry page: </h4>
 +
<p>http://parts.igem.org/Part:BBa_K1827000<br><br>
 +
<h2>b. BBa_K1827001 / composite part</h2>
 +
<p>Designed by: Yuree Chung  Group: iGEM15_HAFS-Korea  (2015-09-14)<br>
 +
<h3>Trichoderma reesei bgl1</h3>
 +
<p>This part contains the entire bgl1 gene from trichoderma reesei. Bgl1 has a significant role in producing cellulase, an enzyme that breaks down cellulose through hydrolysis. It is highly valuable in that any organism that is inserted with this gene through genetic recombination can produce cellulase, thereby being able to break down a major component in plant biomass. Due to the trichoderma reesei's exceptional capacity to produce large amounts of cellulase, this bgl1 gene can be used in generating cellulase in great efficiency. Thus, users can insert this gene to design a genetically modified organism that has obtained the ability to produce cellulase. Regarding that most animals, humans, and even the most-known microorganisms like E.coli do not have cellulase, this part presents us with high applicability in bio-engineering and in diverse industries.<br>
 +
<h4>Sequence>BBa_K1827001 Part-only sequence (1413 bp)</h4>
 +
<p>atggagtaagcaatgttgcccaaggactttcagtgggggttcgccacggctgcctaccagatcgagggcgccgtcgaccaggacggccgcggccccagca
 +
tctgggacacgttctgcgcgcagcccggcaagatcgccgacggctcgtcgggcgtgacggcgtgcgactcgtacaaccgcacggccgaggacattgcgct
 +
gctcaagtcgctcggggccaagagctaccgcttctccatctcgtggtcgcgcatcatccccgagggcggccgcggcgatgccgtcaaccaggcgggcatc
 +
gaccactacgtcaagttcgtcgacgacctgctcgacgccggcatcacgcccttcatcaccctcttccactgggacctgcccgagggcctgcatcagcggt
 +
acggggggctgctgaaccgcaccgagttcccgctcgactttgaaaactacgcccgcgtcatgttcagggcgctgcccaaggtgcgcaactggatcacctt
 +
caacgagccgctgtgctcggccatcccgggctacggctccggcaccttcgcccccggccggcagagcacctcggagccgtggaccgtcggccacaacatc
 +
ctcgtcgcccacggccgcgccgtcaaggcgtaccgcgacgacttcaagcccgccagcggcgacggccagatcggcatcgtcctcaacggcgacttcacct
 +
acccctgggacgccgccgacccggccgacaaggaggcggccgagcggcgcctcgagttcttcacggcctggttcgcagatcccatctacttgggcgacta
 +
cccggcgtcgatgcgcaagcagctgggcgaccggctgccgacctttacgcccgaggagcgcgccctcgtccacggctccaacgacttttacggcatgaac
 +
cactacacgtccaactacatccgccaccgcagctcgcccgcctccgccgacgacaccgtcggcaacgtcgacgtgctcttcaccaacaagcagggcaact
 +
gcatcggccccgagacgcagtccccctggctgcgcccctgtgccgccggcttccgcgacttcctggtgtggatcagcaagaggtacggctacccgcccat
 +
ctacgtgacggagaacggcacgagcatcaagggcgagagcgacttgcccaaggagaagattctcgaagatgacttcagggtcaagtactataacgagtac
 +
atccgtgccatggttaccgccgtggagctggacggggtcaacgtcaaggggtactttgcctggtcgctcatggacaactttgagtgggcggacggctacg
 +
tgacgaggtttggggttacgtatgtggattatgagaatgggcagaagcggttccccaagaagagcgcaaagagcttgaagccgctgtttgacgagctgat
 +
tgcggcggcgtga<br>
 +
<h4>Detailed information at Registry page: </h4>
 +
<p>http://parts.igem.org/Part:BBa_K1827001<br><br><br><br>
 +
<p>* Information about our primers used to make two different parts:<br>
 +
<img src=https://static.igem.org/mediawiki/2015/1/1f/5_Parts_2.jpeg width=80%><br>
 +
<img src=https://static.igem.org/mediawiki/2015/8/89/5_Parts_3.jpeg width=80%>
  
−
<!-- Start of CSS-->
 
−
<style type="text/css">
 
  
−
p, #content {
 
−
color:#85C380;
 
−
}
 
  
−
a, a:visited {
 
−
color:#84FD2C;
 
−
}
 
−
 
−
 
−
 
−
/* PAGE LAYOUT */
 
−
 
−
 
−
/* Set up a width, height and color of the body wrapper*/
 
−
body {
 
−
background-color: #534743;
 
−
}
 
−
 
−
/* Creates a container that will wrap all of the content inside your wiki pages. */
 
−
#mainContainer { 
 
−
width: 980px;
 
−
overflow:hidden;
 
−
float:left;
 
−
margin-left:20px;
 
−
margin-bottom: 10px;
 
−
background-color: #fff;
 
−
border-bottom: 20px solid #963F20;
 
−
}
 
−
 
−
/* Creates the container for the menu */
 
−
#menuContainer  {
 
−
float:left;
 
−
width: 150px;
 
−
padding: 20px 0px;
 
−
background-color: #D65664;
 
−
border-top: 20px solid #963F20;
 
−
font-family: "Lucida Sans Unicode", "Lucida Grande", sans-serif;
 
−
}
 
−
 
−
/* Creates the container for the content */
 
−
#contentContainer {
 
−
padding-top:20px;
 
−
padding-right:10px;
 
−
margin-bottom: 20px;
 
−
width: 800px;
 
−
padding-left: 20px;
 
−
float: left;
 
−
border-top: 20px solid #963F20;
 
−
background-color: #fff;
 
−
font-family: "Lucida Sans Unicode", "Lucida Grande", sans-serif;
 
−
}
 
−
 
−
 
−
/*Set up height place holder for the banner*/
 
−
#bannerContainer {
 
−
height:200px;
 
−
margin:auto;
 
−
text-align:center;
 
−
color: #84F22A;
 
−
}
 
−
 
−
/*VISUAL STYLE (TABLES, FONTS, LINKS, IMAGES, UL) */
 
−
 
−
/*Change the styling of text for everything inside main container*/
 
−
#mainContainer p {
 
−
font-size: 13px;
 
−
color: #000000;
 
−
}
 
−
 
−
/*This changes the color and font family */
 
−
#contentContainer h1, h2, h3, h4, h5, h6 {
 
−
font-family: "Lucida Sans Unicode", "Lucida Grande", sans-serif;
 
−
color: #534743;
 
−
border-bottom: none;
 
−
font-weight: bold;
 
−
margin-top:10px;
 
−
}
 
−
 
−
/*Style of the links - links are different inside the menu */
 
−
#contentContainer a {
 
−
font-weight: bold;
 
−
color: #84FD2C;
 
−
}
 
−
 
−
  /* Styling links on hover- links are different inside the menu */
 
−
#contentContainer a:hover {
 
−
color: #963F20;
 
−
}
 
−
 
−
/*Change the styling of tables */
 
−
        #contentContainer table {
 
−
    border: 2px solid #534743;
 
−
    border-collapse: collapse;
 
−
    margin: auto;
 
−
    margin-bottom: 15px;
 
−
    margin-top: 15px;
 
−
    margin-right: 10px;
 
−
    margin-left: 10px;
 
−
    }
 
−
 
−
/*Change the styling of table cells*/
 
−
    #contentContainer  td {
 
−
    background-color: #fff;
 
−
    padding: 10px;
 
−
    border: 2px solid #534743;
 
−
    border-collapse: collapse;
 
−
    vertical-align: text-top;
 
−
    }
 
−
 
−
 
−
/*Change the styling of table headers */
 
−
    #contentContainer th {
 
−
    background-color: #F4F0D8;
 
−
    padding: 10px;
 
−
    border: 2px solid #534743;
 
−
    border-collapse: collapse;
 
−
    vertical-align: text-top;
 
−
    }
 
−
 
−
 
−
 
−
 
−
/*MENU STYLING */
 
−
 
−
/*Styling for the links in the menu */
 
−
#menuContainer a {
 
−
color: #fff;
 
−
text-decoration:none;
 
−
font-weight: bold;
 
−
}
 
−
 
−
/* Sets the style for lists inside menuContainer  */
 
−
#menuContainer ul {
 
−
list-style: none;
 
−
margin-left:0px;
 
−
}
 
−
 
−
/*Styles the list items to become menu buttons */
 
−
#menuContainer ul li {
 
−
text-align: center;
 
−
display: block;
 
−
width: 100%;
 
−
height:30px;
 
−
padding-top:10px;
 
−
}
 
−
 
−
/*For the menu buttons, changes the color when hovering*/
 
−
#menuContainer li:hover {
 
−
color:  #FFF;
 
−
background-color: #963F20;
 
−
}
 
−
 
−
/*Submenus are not displayed as default*/
 
−
#menuContainer li ul {
 
−
display: none;
 
−
padding-top:15px;
 
−
margin-left: -19px;
 
−
}
 
−
 
−
/*Submenus are displayed when hovering the menu button */
 
−
#menuContainer li:hover ul {
 
−
/*display: inline-block; */
 
−
display: block;
 
−
position: absolute;
 
−
float:right;
 
−
margin-left: 150px;
 
−
margin-top:-42px;
 
−
}
 
−
 
−
/*Style the submenu buttons*/
 
−
#menuContainer li ul li{
 
−
background-color: #84FD2C;
 
−
padding-left:20px;
 
−
padding-right:20px;
 
−
height:30px;
 
−
padding-top:10px;
 
−
margin-top:-2px;
 
−
color: #332B29;
 
−
width: 170px;
 
−
}
 
−
 
−
/*CLASSES */
 
−
 
−
/*Clear class for all the pages, adds spacing too*/
 
−
.clear{
 
−
clear:both;
 
−
height: 10px;
 
−
}
 
−
 
−
 
−
/* highlight box for special messages */
 
−
          .highlightBox {
 
−
            width:500px;
 
−
            margin:auto;
 
−
            background-color: #F4F0D8;
 
−
    margin-bottom: 15px;
 
−
    margin-top: 15px;
 
−
    padding: 15px;
 
−
    padding-top: 5px;
 
−
            }
 
−
 
−
</style>
 
−
<!-- End of CSS -->
 
−
 
−
 
−
<h2> Part Documentation</h2>
 
−
 
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
 
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
 
−
 
−
 
−
<div class="highlightBox">
 
−
<h4>Note</h4>
 
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
 
−
</div>
 
−
 
−
 
−
 
−
<h4>Adding parts to the registry</h4>
 
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
 
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
 
−
 
−
 
−
<h4>What information do I need to start putting my parts on the Registry?</h4>
 
−
<p>The information needed to initially create a part on the Registry is:</p>
 
−
<ul>
 
−
<li>Part Name</li>
 
−
<li>Part type</li>
 
−
<li>Creator</li>
 
−
<li>Sequence</li>
 
−
<li>Short Description (60 characters on what the DNA does)</li>
 
−
<li>Long Description (Longer description of what the DNA does)</li>
 
−
<li>Design considerations</li>
 
−
</ul>
 
−
 
−
<p>
 
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
 
−
 
−
 
−
 
−
 
−
 
−
 
−
<h4>Inspiration</h4>
 
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
 
−
 
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
 
−
<ul>
 
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
 
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
 
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
 
−
</ul>
 
−
 
−
 
−
 
−
<h4>Part Table </h4>
 
−
</html>
 
−
<groupparts>iGEM015 Example</groupparts>
 
−
<html>
 
−
 
−
 
−
 
−
</div>
 
 
</html>
 
</html>

Latest revision as of 03:25, 19 September 2015

PART


HAFS-Korea Parts Submissions

HAFS-Korea has created its own parts by extracting genes from E.coli and T.reesei(which was indeed arduous job than just using the existin gene from offered DNA kits). We conducted our experiment with pET28a vector(kanamicine resistance), but constructed our parts with pSB1C3 vector which has chlorampenicol resistance. Moreover, we ordered different primers for part submissions. For iGEMers, we divided our two genes and cloned in different pSB1CB vector so that they can use each function of our two different genes.

a. BBa_K1827000/ composite part

Designed by: Yuree Chung Group: iGEM15_HAFS-Korea (2015-09-14)

E.coli signal-lpp-ompA

This part consists of the three following genes extracted from E.coli: lpp signal sequence, lpp gene, and ompA gene. The lpp signal sequence allows the lpp and ompA sequence to be expressed successfully. The lpp(lipoprotein) gene that is used in this part consists of the first 9 amino acids of lpp gene, which can still be expressed as proper-functioning lipoprotein. The ompA gene starts from the 46th amino acid to 159th amino acid of the original ompA gene. The whole part is used for creating a specific protein complex called lpp-ompA complex, present in the cellular membrane of E.coli. This complex can attach almost every molecule to the membrane, thereby serving as an effective biotechnological and industrial tool with great potential. The users of this part can insert adequate genes (whether those are from E.coli or from other species) next to this sequence to give E.coli certain function that does not exist in normal E.coli. Thus, they can use this part as a basis to design their own E.coli, suitable for their purpose. As it allows signaling molecules and enzymes to be attached with ease, it has a wide variety of applications, from detection of specific heavy metal to breakdown of macro-molecules. This part, although already used by some people, is meaningful and economical in that it contains only the necessary parts in expressing the protein complex that can be used in various ways by other people. Also, it allows diverse extracellular processes to be carried out without interrupting the inner mechanisms of E.coli, since the complex presents the molecule outside the cell.

>BBa_K1827000 Part-only sequence (393 bp)

aaagctactaaactggtactgggcaacaacaatggcccgacccatgaaaacaacaacaatggcccgacccatgaaaaccaactgggcgctggtgcttttg gtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagc tcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaa tccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgt

Detailed information at Registry page:

http://parts.igem.org/Part:BBa_K1827000

b. BBa_K1827001 / composite part

Designed by: Yuree Chung Group: iGEM15_HAFS-Korea (2015-09-14)

Trichoderma reesei bgl1

This part contains the entire bgl1 gene from trichoderma reesei. Bgl1 has a significant role in producing cellulase, an enzyme that breaks down cellulose through hydrolysis. It is highly valuable in that any organism that is inserted with this gene through genetic recombination can produce cellulase, thereby being able to break down a major component in plant biomass. Due to the trichoderma reesei's exceptional capacity to produce large amounts of cellulase, this bgl1 gene can be used in generating cellulase in great efficiency. Thus, users can insert this gene to design a genetically modified organism that has obtained the ability to produce cellulase. Regarding that most animals, humans, and even the most-known microorganisms like E.coli do not have cellulase, this part presents us with high applicability in bio-engineering and in diverse industries.

Sequence>BBa_K1827001 Part-only sequence (1413 bp)

atggagtaagcaatgttgcccaaggactttcagtgggggttcgccacggctgcctaccagatcgagggcgccgtcgaccaggacggccgcggccccagca tctgggacacgttctgcgcgcagcccggcaagatcgccgacggctcgtcgggcgtgacggcgtgcgactcgtacaaccgcacggccgaggacattgcgct gctcaagtcgctcggggccaagagctaccgcttctccatctcgtggtcgcgcatcatccccgagggcggccgcggcgatgccgtcaaccaggcgggcatc gaccactacgtcaagttcgtcgacgacctgctcgacgccggcatcacgcccttcatcaccctcttccactgggacctgcccgagggcctgcatcagcggt acggggggctgctgaaccgcaccgagttcccgctcgactttgaaaactacgcccgcgtcatgttcagggcgctgcccaaggtgcgcaactggatcacctt caacgagccgctgtgctcggccatcccgggctacggctccggcaccttcgcccccggccggcagagcacctcggagccgtggaccgtcggccacaacatc ctcgtcgcccacggccgcgccgtcaaggcgtaccgcgacgacttcaagcccgccagcggcgacggccagatcggcatcgtcctcaacggcgacttcacct acccctgggacgccgccgacccggccgacaaggaggcggccgagcggcgcctcgagttcttcacggcctggttcgcagatcccatctacttgggcgacta cccggcgtcgatgcgcaagcagctgggcgaccggctgccgacctttacgcccgaggagcgcgccctcgtccacggctccaacgacttttacggcatgaac cactacacgtccaactacatccgccaccgcagctcgcccgcctccgccgacgacaccgtcggcaacgtcgacgtgctcttcaccaacaagcagggcaact gcatcggccccgagacgcagtccccctggctgcgcccctgtgccgccggcttccgcgacttcctggtgtggatcagcaagaggtacggctacccgcccat ctacgtgacggagaacggcacgagcatcaagggcgagagcgacttgcccaaggagaagattctcgaagatgacttcagggtcaagtactataacgagtac atccgtgccatggttaccgccgtggagctggacggggtcaacgtcaaggggtactttgcctggtcgctcatggacaactttgagtgggcggacggctacg tgacgaggtttggggttacgtatgtggattatgagaatgggcagaagcggttccccaagaagagcgcaaagagcttgaagccgctgtttgacgagctgat tgcggcggcgtga

Detailed information at Registry page:

http://parts.igem.org/Part:BBa_K1827001



* Information about our primers used to make two different parts: