Difference between revisions of "Team:HAFS-Korea/Parts"

(Replaced content with "{{HAFS-Korea}} <html> <h2>PART</h2> </html> Bgl1 http://parts.igem.org/Part:BBa_K1827001 Lpp-OmpA http://parts.igem.org/Part:BBa_K1827000")
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
{{HAFS-Korea}}
 
{{HAFS-Korea}}
 
<html>
 
<html>
−
<h2>PART</h2>
+
<h2>PART</h2><br>
−
</html>
+
<h4>HAFS-Korea Parts Submissions</h4>
−
Bgl1  
+
<p>HAFS-Korea has created its own parts by extracting genes from E.coli and T.reesei(which was indeed arduous job than just using the existin gene from offered DNA kits). We conducted our experiment with pET28a vector(kanamicine resistance), but constructed our parts with pSB1C3 vector which has chlorampenicol resistance. Moreover, we ordered different primers for part submissions. For iGEMers, we divided our two genes and cloned in different pSB1CB vector  so that they can use each function of our two different genes.
 +
<img src=https://static.igem.org/mediawiki/2015/5/5e/5_Parts.png width=80%><br><br>
 +
<h2>a. BBa_K1827000/ composite part</h2>
 +
<p>Designed by: Yuree Chung  Group: iGEM15_HAFS-Korea  (2015-09-14)<br>
 +
<h3>E.coli signal-lpp-ompA</h3>
 +
<p>This part consists of the three following genes extracted from E.coli: lpp signal sequence, lpp gene, and ompA gene. The lpp signal sequence allows the lpp and ompA sequence to be expressed successfully. The lpp(lipoprotein) gene that is used in this part consists of the first 9 amino acids of lpp gene, which can still be expressed as proper-functioning lipoprotein. The ompA gene starts from the 46th amino acid to 159th amino acid of the original ompA gene. The whole part is used for creating a specific protein complex called lpp-ompA complex, present in the cellular membrane of E.coli. This complex can attach almost every molecule to the membrane, thereby serving as an effective biotechnological and industrial tool with great potential. The users of this part can insert adequate genes (whether those are from E.coli or from other species) next to this sequence to give E.coli certain function that does not exist in normal E.coli. Thus, they can use this part as a basis to design their own E.coli, suitable for their purpose. As it allows signaling molecules and enzymes to be attached with ease, it has a wide variety of applications, from detection of specific heavy metal to breakdown of macro-molecules. This part, although already used by some people, is meaningful and economical in that it contains only the necessary parts in expressing the protein complex that can be used in various ways by other people. Also, it allows diverse extracellular processes to be carried out without interrupting the inner mechanisms of E.coli, since the complex presents the molecule outside the cell.<br>
 +
<h4>>BBa_K1827000 Part-only sequence (393 bp)</h4>
 +
aaagctactaaactggtactgggcaacaacaatggcccgacccatgaaaacaacaacaatggcccgacccatgaaaaccaactgggcgctggtgcttttg
 +
gtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagc
 +
tcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaa
 +
tccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgt
 +
<h4>Detailed information at Registry page: </h4>
 +
<p>http://parts.igem.org/Part:BBa_K1827000<br><br>
 +
<h2>b. BBa_K1827001 / composite part</h2>
 +
<p>Designed by: Yuree Chung  Group: iGEM15_HAFS-Korea  (2015-09-14)<br>
 +
<h3>Trichoderma reesei bgl1</h3>
 +
<p>This part contains the entire bgl1 gene from trichoderma reesei. Bgl1 has a significant role in producing cellulase, an enzyme that breaks down cellulose through hydrolysis. It is highly valuable in that any organism that is inserted with this gene through genetic recombination can produce cellulase, thereby being able to break down a major component in plant biomass. Due to the trichoderma reesei's exceptional capacity to produce large amounts of cellulase, this bgl1 gene can be used in generating cellulase in great efficiency. Thus, users can insert this gene to design a genetically modified organism that has obtained the ability to produce cellulase. Regarding that most animals, humans, and even the most-known microorganisms like E.coli do not have cellulase, this part presents us with high applicability in bio-engineering and in diverse industries.<br>
 +
<h4>Sequence>BBa_K1827001 Part-only sequence (1413 bp)</h4>
 +
<p>atggagtaagcaatgttgcccaaggactttcagtgggggttcgccacggctgcctaccagatcgagggcgccgtcgaccaggacggccgcggccccagca
 +
tctgggacacgttctgcgcgcagcccggcaagatcgccgacggctcgtcgggcgtgacggcgtgcgactcgtacaaccgcacggccgaggacattgcgct
 +
gctcaagtcgctcggggccaagagctaccgcttctccatctcgtggtcgcgcatcatccccgagggcggccgcggcgatgccgtcaaccaggcgggcatc
 +
gaccactacgtcaagttcgtcgacgacctgctcgacgccggcatcacgcccttcatcaccctcttccactgggacctgcccgagggcctgcatcagcggt
 +
acggggggctgctgaaccgcaccgagttcccgctcgactttgaaaactacgcccgcgtcatgttcagggcgctgcccaaggtgcgcaactggatcacctt
 +
caacgagccgctgtgctcggccatcccgggctacggctccggcaccttcgcccccggccggcagagcacctcggagccgtggaccgtcggccacaacatc
 +
ctcgtcgcccacggccgcgccgtcaaggcgtaccgcgacgacttcaagcccgccagcggcgacggccagatcggcatcgtcctcaacggcgacttcacct
 +
acccctgggacgccgccgacccggccgacaaggaggcggccgagcggcgcctcgagttcttcacggcctggttcgcagatcccatctacttgggcgacta
 +
cccggcgtcgatgcgcaagcagctgggcgaccggctgccgacctttacgcccgaggagcgcgccctcgtccacggctccaacgacttttacggcatgaac
 +
cactacacgtccaactacatccgccaccgcagctcgcccgcctccgccgacgacaccgtcggcaacgtcgacgtgctcttcaccaacaagcagggcaact
 +
gcatcggccccgagacgcagtccccctggctgcgcccctgtgccgccggcttccgcgacttcctggtgtggatcagcaagaggtacggctacccgcccat
 +
ctacgtgacggagaacggcacgagcatcaagggcgagagcgacttgcccaaggagaagattctcgaagatgacttcagggtcaagtactataacgagtac
 +
atccgtgccatggttaccgccgtggagctggacggggtcaacgtcaaggggtactttgcctggtcgctcatggacaactttgagtgggcggacggctacg
 +
tgacgaggtttggggttacgtatgtggattatgagaatgggcagaagcggttccccaagaagagcgcaaagagcttgaagccgctgtttgacgagctgat
 +
tgcggcggcgtga<br>
 +
<h4>Detailed information at Registry page: </h4>
 +
<p>http://parts.igem.org/Part:BBa_K1827001<br><br><br><br>
 +
<p>* Information about our primers used to make two different parts:<br>
 +
<img src=https://static.igem.org/mediawiki/2015/1/1f/5_Parts_2.jpeg width=80%><br>
 +
<img src=https://static.igem.org/mediawiki/2015/8/89/5_Parts_3.jpeg width=80%>
  
−
http://parts.igem.org/Part:BBa_K1827001
 
  
  
−
 
+
</html>
−
Lpp-OmpA
+
−
 
+
−
http://parts.igem.org/Part:BBa_K1827000
+

Latest revision as of 03:25, 19 September 2015

PART


HAFS-Korea Parts Submissions

HAFS-Korea has created its own parts by extracting genes from E.coli and T.reesei(which was indeed arduous job than just using the existin gene from offered DNA kits). We conducted our experiment with pET28a vector(kanamicine resistance), but constructed our parts with pSB1C3 vector which has chlorampenicol resistance. Moreover, we ordered different primers for part submissions. For iGEMers, we divided our two genes and cloned in different pSB1CB vector so that they can use each function of our two different genes.

a. BBa_K1827000/ composite part

Designed by: Yuree Chung Group: iGEM15_HAFS-Korea (2015-09-14)

E.coli signal-lpp-ompA

This part consists of the three following genes extracted from E.coli: lpp signal sequence, lpp gene, and ompA gene. The lpp signal sequence allows the lpp and ompA sequence to be expressed successfully. The lpp(lipoprotein) gene that is used in this part consists of the first 9 amino acids of lpp gene, which can still be expressed as proper-functioning lipoprotein. The ompA gene starts from the 46th amino acid to 159th amino acid of the original ompA gene. The whole part is used for creating a specific protein complex called lpp-ompA complex, present in the cellular membrane of E.coli. This complex can attach almost every molecule to the membrane, thereby serving as an effective biotechnological and industrial tool with great potential. The users of this part can insert adequate genes (whether those are from E.coli or from other species) next to this sequence to give E.coli certain function that does not exist in normal E.coli. Thus, they can use this part as a basis to design their own E.coli, suitable for their purpose. As it allows signaling molecules and enzymes to be attached with ease, it has a wide variety of applications, from detection of specific heavy metal to breakdown of macro-molecules. This part, although already used by some people, is meaningful and economical in that it contains only the necessary parts in expressing the protein complex that can be used in various ways by other people. Also, it allows diverse extracellular processes to be carried out without interrupting the inner mechanisms of E.coli, since the complex presents the molecule outside the cell.

>BBa_K1827000 Part-only sequence (393 bp)

aaagctactaaactggtactgggcaacaacaatggcccgacccatgaaaacaacaacaatggcccgacccatgaaaaccaactgggcgctggtgcttttg gtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagc tcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaa tccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgt

Detailed information at Registry page:

http://parts.igem.org/Part:BBa_K1827000

b. BBa_K1827001 / composite part

Designed by: Yuree Chung Group: iGEM15_HAFS-Korea (2015-09-14)

Trichoderma reesei bgl1

This part contains the entire bgl1 gene from trichoderma reesei. Bgl1 has a significant role in producing cellulase, an enzyme that breaks down cellulose through hydrolysis. It is highly valuable in that any organism that is inserted with this gene through genetic recombination can produce cellulase, thereby being able to break down a major component in plant biomass. Due to the trichoderma reesei's exceptional capacity to produce large amounts of cellulase, this bgl1 gene can be used in generating cellulase in great efficiency. Thus, users can insert this gene to design a genetically modified organism that has obtained the ability to produce cellulase. Regarding that most animals, humans, and even the most-known microorganisms like E.coli do not have cellulase, this part presents us with high applicability in bio-engineering and in diverse industries.

Sequence>BBa_K1827001 Part-only sequence (1413 bp)

atggagtaagcaatgttgcccaaggactttcagtgggggttcgccacggctgcctaccagatcgagggcgccgtcgaccaggacggccgcggccccagca tctgggacacgttctgcgcgcagcccggcaagatcgccgacggctcgtcgggcgtgacggcgtgcgactcgtacaaccgcacggccgaggacattgcgct gctcaagtcgctcggggccaagagctaccgcttctccatctcgtggtcgcgcatcatccccgagggcggccgcggcgatgccgtcaaccaggcgggcatc gaccactacgtcaagttcgtcgacgacctgctcgacgccggcatcacgcccttcatcaccctcttccactgggacctgcccgagggcctgcatcagcggt acggggggctgctgaaccgcaccgagttcccgctcgactttgaaaactacgcccgcgtcatgttcagggcgctgcccaaggtgcgcaactggatcacctt caacgagccgctgtgctcggccatcccgggctacggctccggcaccttcgcccccggccggcagagcacctcggagccgtggaccgtcggccacaacatc ctcgtcgcccacggccgcgccgtcaaggcgtaccgcgacgacttcaagcccgccagcggcgacggccagatcggcatcgtcctcaacggcgacttcacct acccctgggacgccgccgacccggccgacaaggaggcggccgagcggcgcctcgagttcttcacggcctggttcgcagatcccatctacttgggcgacta cccggcgtcgatgcgcaagcagctgggcgaccggctgccgacctttacgcccgaggagcgcgccctcgtccacggctccaacgacttttacggcatgaac cactacacgtccaactacatccgccaccgcagctcgcccgcctccgccgacgacaccgtcggcaacgtcgacgtgctcttcaccaacaagcagggcaact gcatcggccccgagacgcagtccccctggctgcgcccctgtgccgccggcttccgcgacttcctggtgtggatcagcaagaggtacggctacccgcccat ctacgtgacggagaacggcacgagcatcaagggcgagagcgacttgcccaaggagaagattctcgaagatgacttcagggtcaagtactataacgagtac atccgtgccatggttaccgccgtggagctggacggggtcaacgtcaaggggtactttgcctggtcgctcatggacaactttgagtgggcggacggctacg tgacgaggtttggggttacgtatgtggattatgagaatgggcagaagcggttccccaagaagagcgcaaagagcttgaagccgctgtttgacgagctgat tgcggcggcgtga

Detailed information at Registry page:

http://parts.igem.org/Part:BBa_K1827001



* Information about our primers used to make two different parts: