Difference between revisions of "Team:Edinburgh/Description"

Line 111: Line 111:
 
       </header>
 
       </header>
  
−
      <section class="ss-style-halfcircle">
+
 
−
<h2>Our Hypothesis</h2>
+
−
                <p>
+
−
We believe that drug testing kits should be safe, affordable, and readily available to those at risk.
+
−
<br>
+
−
<br>
+
−
Where tests are affordable and understandable to the end-user, accuracy, and thus safety, is compromised. It is clear that the current methods for checking drugs are not adequate. To change this we envisioned a test designed and modelled around the fundamental needs of the users. This is a test built from their personal input and experience, to create the most useful and appropriate device possible. 
+
−
<br>
+
−
<br>
+
−
We see an opportunity for synthetic biology to provide us with the winning combination of accuracy, ease of use, adaptability, low-cost and portability - a mix that neither simple chemical test-kits nor high-end analytical chemistry can provide. Synthetic biology has allowed us to present the best aspects of all the existing methodologies in one simple device, creating a feasible method of getting accurate safety information to all those who need it.
+
−
<br>
+
−
<br>
+
−
Through hard work, innovative thinking, strong end-user engagement and of course a hefty dose of synthetic biology, we embarked on a mission to use synthetic biology to make a difference.
+
−
                </p>
+
 
       </section>
 
       </section>
 
       <section class="color ss-style-bigtriangle">
 
       <section class="color ss-style-bigtriangle">
 
               <h2>A Cell-free, Paper-based Biosensor</h2>
 
               <h2>A Cell-free, Paper-based Biosensor</h2>
 
                   <p>
 
                   <p>
−
Edinburgh iGEM 2015 has produced a cell-free, paper-based biosensor. Detection enzymes were fused to carbohydrate binding modules (CBD) and placed on paper for a cheap, fast and highly portable detection system.  
+
The utilization of a cell-free system was the most appropriate choice for this project, for it was conducive to the biosensor being used outside of the laboratory in a safe and effective manner. Indeed, it is paramount that users of the biosensor are not exposed to potential pathogens, and that that the environment is protected against the accidental release of genetically modified organisms. Since our device is intended to be used primarily by people with little or no training, the best way to provide this level of safety and security was to ensure that no live organisms were incorporated in the test.
 
<br>
 
<br>
 
<br>
 
<br>
−
A cell-free system was a must for this project from day one. We instantly recognised this as the best method to take synthetic biology out of the lab and into the streets. There were a number of reasons this approach was imperative with the most important being that this project is geared around improving the safety for the users.  To ensure that while utilising our biosensor the users are not exposed to any potential pathogens is paramount, as well as ensuring environmental protection by preventing the accidental release of genetically modified organisms. As our device is intended to be used primarily by non-scientists, and people with little or no training, the only way to provide adequate safety and security was to ensure no live organisms were implicated in the test.
+
Avoiding the use of live organisms also allows for a degree of portability, for regulation would have otherwise hindered the implementation in non-laboratory environments, including the environments in which we intend to employ the device (see p&p for more - link to our story). Furthermore, there would be a long and costly legal process to get our biosensor the green light if it were to utilize genetically modified organisms.  
−
Avoidance of the use of live organisms in our device also allows for the portability of our device. Regulation would otherwise hinder the implementation of our device in non-laboratory environments such as those we intend to place the device in (see p&p for more) and would likely result in a long and costly legal process to get our biosensor the green light.  
+
 
<br>
 
<br>
 
<br>
 
<br>
−
The choice of a paper-based biosensor was also fundamental to the success of our device. Using a paper-based system reduced the cost of our device massively with estimates of the biosensor capable of costing less than 10p per test paper. (REF)  
+
The choice of a paper-based biosensor was also fundamental to its ability to compete on the free market, as this reduced the estimated cost to no more than 10 pence per test paper (1).
 +
 
  
 
         </p>
 
         </p>
Line 149: Line 136:
 
           <h2>Enzymes or Genes?</h2>
 
           <h2>Enzymes or Genes?</h2>
 
           <p>
 
           <p>
−
Our biosensor is built on an enzyme-on-paper approach to detection of the target compounds. In the earliest stages of design conception we contemplated using gene networks to operate our detection system, however our policy and practices research quickly led us to re-evaluate. Through conversations with our end users and professionals working directly with the users (see p&p) we quickly learnt that both recreational and problematic users would be seriously deterred from using the sensor due to long waiting periods for results. It became clear that minimising time-to-detection had to be a priority for our design. An enzyme-on-paper system, with its increased speed of detection and similar stability to paper-gene networks, would be the best method of producing results quickly enough to meet the demands of our end-users.  
+
In the earliest stages of design, we contemplated using gene networks to operate our detection system; however, our human practices research quickly led us to re-evaluate this decision. Through conversations with our end users, as well as professionals working directly with the users (see p&p- link to our story), we quickly learnt that users would be seriously deterred from using the sensor if they were subjected to long waiting-times for results. Thus, it became clear that minimising time-to-detection was a priority for our design, and that using an enzyme system, with its increased speed of detection and stability compared to gene networks, was the best method to meet this criteria.
 +
 
 
           </p>
 
           </p>
 
         </div>
 
         </div>
Line 156: Line 144:
 
         <h2>Producing the Enzymes</h2>
 
         <h2>Producing the Enzymes</h2>
 
         <p>
 
         <p>
−
The vector E. coli BL21 (de3) was used for the production of all enzymes used in our biosensor. All constructs were produced in the chloramphenicol resistant backbone pSB1C3, and were lactose inducible. The lactose analogue IPTG was used to activate the LacI promoter and ensure expression of the desired gene constructs when producing the proteins for our sensor. The assembly standards RFC 10 and RFC 25 were both used in the production of the enzymes. RFC 25 was used to fuse the CBDs and the detection enzymes together. RFC 10 was used for introduction of the promoter to the plasmid
+
In order to decrease the cost of the biosensor, we decided not to purify the enzymes, because this is both a tedious and expensive process. Instead, we will place crude cell lysate on each of the bioactive zones. By transforming the plasmids in the chassis Escherichia coli BL21 (DE3), we can increase enzyme production. This is a result of it being a robust and non-pathogenic E. coli B strain able to grow vigorously in minimal media in comparison to the Top10s we completed our cloning in. It is also deficient in ompT and lon; two proteases that could cause problems with protein isolation (2).
 +
<br>
 +
<br>
 +
All protein expression is under the control of the lactose induced expression cassette (BBa_K314103) produced by iGEM10_Washington. This expression cassette includes a LacI generator and a lactose inducible promoter with the Elowitz standard RBS. By putting the lac operon in front of the enzyme coding sequence, we should be able to regulate transcription of the gene via production of the LacI repressor protein. IPTG, an analogue of lactose, can be used to induce protein expression (3). Having a repressible promoter is key in situations where the proteins can be toxic to the cells in high concentrations (4).
 +
<br>
 
       </p>
 
       </p>
 
       </section>
 
       </section>
Line 166: Line 158:
 
         </div>
 
         </div>
 
         <div class="column text">
 
         <div class="column text">
−
           <h2>Making it stick- CBDs</h2>
+
           <h2>Immobilising the Enzymes</h2>
 
           <p>
 
           <p>
−
In creating a paper-based biosensor the use of carbohydrate-binding-modules (CBD) was a cornerstone in the production of our device as we strived to achieve the highest stability.  
+
After considering the large amount of diffusion of the crude cell lysate through the paper, we thought about methods to immobilise the enzymes so they remain in the intended bioactive zones. This led us to fusing our enzymes to Carbohydrate Binding Domains (CBDs) to ensure the enzymes would stick to the paper.
−
This summer we developed our constructs with the five CBDs that we thought would work well in our biosensor. These CBDs were selected from the distribution kit and from parts produced by previous iGEM teams for their varying affinities for paper cellulose and because they were previously well-characterised.
+
 
<br>
 
<br>
 
<br>
 
<br>
−
The CBDs chosen were CBDclos, CBDcex, CBDcenA, CBDcipA and dCBD. The CBDs …. and …. were taken from the iGEM 2015 distribution kit and the CBDs …. , ….. and CBDcipA were produced from parts created/characterised by the Imperial iGEM team 2014. All CBDs were fused to our detection enzymes to create an array of composite parts using both N-terminal and C-terminal fusions. All CBDs used were RFC 25 compatible, with the exception of CBDcipA which was made RFC 25 compatible by our team.  
+
CBDs are proteins that recognise and bind specifically to polysaccharides, such as cellulose (5). Their advantages include: the fact that they are independent folding units, having inexpensive and abundant attachment matrices and, most importantly, having controllable binding affinities (6). This means that we can make sure enzymes that work at different speeds are fused to the CBD with an appropriate binding affinity in order to give the optimal concentration of enzyme on paper.
 
<br>
 
<br>
 +
        </p>
 +
      </section>
 +
        <section class="col-2 ss-style-halfcircle">
 +
        <div class="column">
 +
          <span class="icon icon-images">
 +
            <img src="whiteneedle.png">
 +
          </span>
 +
        </div>
 +
        <div class="column text">
 +
          <h2>RFC10 vs RFC25</h2>
 +
          <p>
 +
        One of the goals of our biosensor is to make it a proof of concept for future biosensors with interchangeable parts. This requires us to think about how every enzyme and CBD can be exchanged for a different enzyme or CBD. This standardisation was started with the BioBrick assembly method, such that every part has complementary terminals. The original BioBrick assembly method (RFC10), however, does not allow for the construction of protein fusions, as there is an 8-nucleotide scar between the two genes leaving a frameshift mutation (7).
 
<br>
 
<br>
−
(All CBDs used were characterised, with the exception of CBDcipA (see characterisation page for more information).)
+
<br>
 +
This led us to use the Freiburg format of RFC25 since everything we did relied on protein fusions. RFC25 is compatible with all existing parts in RFC10 and only leaves a 6-nucleotide scar, which allows the genes to stay in frame. The prefix is
 +
<br>
 +
GAATTCGCGGCCGCTTCTAGATGGCCGGC
 +
<br>
 +
containing the restriction sites EcoRI, NotI, XbaI and NgoMIV and the suffix is
 +
<br>
 +
ACCGGTTAATACTAGTAGCGGCCGCTGCAG 
 +
<br>
 +
containing the restriction sites AgeI, SpeI, NotI and PstI (8). This meant that our protein-coding genes could be in frame in a single plasmid so they will produce fused, functional proteins when transcribed.
 +
 
           </p>
 
           </p>
 +
        </div>
 +
      </section>
 +
      <section class="color ss-style-bigtriangle">
 +
        <h2>Freeze drying</h2>
 +
        <p>
 +
The final step in creating our biosensor is ensuring its mobility. This is done by freeze-drying all of the enzymes on paper. This process increases stability and shelf-life of enzymes so that freshness, and therefore reliability, of the biosensors is not compromised. It further involves freezing the sample, as well as two subsequent stages of drying (9). Freeze-drying with 20% trehalose is a method of further increasing the stability of the enzymes (10).
 +
 +
        </p>
 
         </div>
 
         </div>
 
       </section>
 
       </section>
Line 182: Line 203:
 
         <h2>An adaptable design</h2>
 
         <h2>An adaptable design</h2>
 
         <p>
 
         <p>
−
Edinburgh iGEM 2015’s biosensor may leave a great legacy in improving drug safety but our impact does not end there. Our cell-free, paper-based biosensor is a fluid and adaptable model which can be easily manipulated to serve a range of analytical purposes, bringing synthetic biology to the forefront of detection sciences.  
+
Whilst Edinburgh iGEM 2015’s biosensor may leave a great legacy in improving drug safety, we hope the impact it has does not end there. Our biosensor is a fluid and adaptable model that can be easily manipulated to serve a range of analytical purposes, bringing synthetic biology to the forefront of detection sciences.  
 
<br>
 
<br>
 
<br>
 
<br>
−
Through exchange of standard biological parts, the device can easily be produced with different enzymes by switching the genes in our backbone. This allows our biosensor to be important not only as a life-saving tool for drug users, but as a proof of concept with much wider applications. Replacing the enzymes in the biosensor could allow our device to test not only for the drugs we worked with this summer, but for a large number of drugs or contaminants. This extends even further with  the use of different enzymes allowing for the detection of counterfeit-pharmaceutical drugs, as well as providing a fast, inexpensive and accurate system for innumerable compounds of importance in environmental, food, material and medical analytical science. (Find out more in Future Applications).
+
Through exchange of standard biological parts, the device can easily be produced with different enzymes by switching the genes in our backbone. This allows our biosensor to be important not only as a harm reduction tool for drug users, but as a proof of concept with much wider applications. Exchanging the enzymes in the biosensor could allow for our device to test for a multitude of compounds, be they drugs, contaminants or counterfeit-pharmaceuticals. (Find out more in Future Applications- link to future applications).
 
<br>
 
<br>
 
<br>
 
<br>
−
Our device is far more than a tool to improve the safety of a small group of users. Its user-targeted design and enhanced biosafety allows our biosensor to bring synthetic biology out of the lab and onto the streets in ways that have not been possible before.  
+
Our device is far more than a tool to improve the safety of a small group of user; its user-targeted design and enhanced biosafety allows our biosensor to bring synthetic biology out of the lab and into society in ways that have not been possible before.  
 +
 
 
         </p>
 
         </p>
 +
        </div>
 
       </section>
 
       </section>
 +
      <section class="color ss-style-bigtriangle">
 +
        <h2>References</h2>
 +
        <p>
 +
1. Pelton, R. (2009) Bioactive Paper Provides Low Cost Platform for Diagnostics. Trends in Analytical Chemistry, 28(8), 925-942.
 +
2. Chart, H., Smith, H. R., La Ragione, R. M., & Woodward, M. J. (2000). An investigation into the pathogenic properties of Escherichia coli strains BLR, BL21, DH5α and EQ1. Journal of applied microbiology, 89(6), 1048-1058.
 +
3. K.S. Matthews, J.C. Nichols (1998). Lactose repressor protein: functional properties and structure. Prog Nucleic Acid Res Mol Biol, 58, 127–164
 +
4. O'Connor, C. D., & Timmis, K. N. (1987). Highly repressible expression system for cloning genes that specify potentially toxic proteins. Journal of bacteriology, 169(10), 4457-4462.
 +
5. Boraston, A. B., Bolam, D., Gilbert, H., & Davies, G. J. G. J. (2004). Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem. J, 382, 769-781.
 +
6. Bayer, E. A., Morag, E., & Lamed, R. (1994). The cellulosome—a treasure-trove for biotechnology. Trends in biotechnology, 12(9), 379-386.
 +
7. Anderson, J., Dueber, J. E., Leguia, M., Wu, G. C., Goler, J. A., Arkin, A. P., & Keasling, J. D. (2010). BglBricks: A flexible standard for biological part assembly. Journal of biological engineering, 4(1), 1-12.
 +
8. Grünberg, R., Ferrar, T. S., van der Sloot, A. M., Constante, M., & Serrano, L. (2010). Building blocks for protein interaction devices. Nucleic acids research, gkq152.
 +
9. Roy, I., & Gupta, M. N. (2004). Freeze‐drying of proteins: some emerging concerns. Biotechnology and applied biochemistry, 39(2), 165-177.
 +
10. Mazzobre, M. F., & Buera, M. D. P. (1999). Combined effects of trehalose and cations on the thermal resistance of β-galactosidase in freeze-dried systems. Biochimica Et Biophysica Acta (BBA)-General Subjects, 1473(2), 337-344.
  
−
   
+
        </p>
  
 
</div>
 
</div>
 
</body>
 
</body>
 
</html>
 
</html>

Revision as of 16:03, 11 September 2015

gh

Description




A Cell-free, Paper-based Biosensor

The utilization of a cell-free system was the most appropriate choice for this project, for it was conducive to the biosensor being used outside of the laboratory in a safe and effective manner. Indeed, it is paramount that users of the biosensor are not exposed to potential pathogens, and that that the environment is protected against the accidental release of genetically modified organisms. Since our device is intended to be used primarily by people with little or no training, the best way to provide this level of safety and security was to ensure that no live organisms were incorporated in the test.

Avoiding the use of live organisms also allows for a degree of portability, for regulation would have otherwise hindered the implementation in non-laboratory environments, including the environments in which we intend to employ the device (see p&p for more - link to our story). Furthermore, there would be a long and costly legal process to get our biosensor the green light if it were to utilize genetically modified organisms.

The choice of a paper-based biosensor was also fundamental to its ability to compete on the free market, as this reduced the estimated cost to no more than 10 pence per test paper (1).

Enzymes or Genes?

In the earliest stages of design, we contemplated using gene networks to operate our detection system; however, our human practices research quickly led us to re-evaluate this decision. Through conversations with our end users, as well as professionals working directly with the users (see p&p- link to our story), we quickly learnt that users would be seriously deterred from using the sensor if they were subjected to long waiting-times for results. Thus, it became clear that minimising time-to-detection was a priority for our design, and that using an enzyme system, with its increased speed of detection and stability compared to gene networks, was the best method to meet this criteria.

Producing the Enzymes

In order to decrease the cost of the biosensor, we decided not to purify the enzymes, because this is both a tedious and expensive process. Instead, we will place crude cell lysate on each of the bioactive zones. By transforming the plasmids in the chassis Escherichia coli BL21 (DE3), we can increase enzyme production. This is a result of it being a robust and non-pathogenic E. coli B strain able to grow vigorously in minimal media in comparison to the Top10s we completed our cloning in. It is also deficient in ompT and lon; two proteases that could cause problems with protein isolation (2).

All protein expression is under the control of the lactose induced expression cassette (BBa_K314103) produced by iGEM10_Washington. This expression cassette includes a LacI generator and a lactose inducible promoter with the Elowitz standard RBS. By putting the lac operon in front of the enzyme coding sequence, we should be able to regulate transcription of the gene via production of the LacI repressor protein. IPTG, an analogue of lactose, can be used to induce protein expression (3). Having a repressible promoter is key in situations where the proteins can be toxic to the cells in high concentrations (4).

Immobilising the Enzymes

After considering the large amount of diffusion of the crude cell lysate through the paper, we thought about methods to immobilise the enzymes so they remain in the intended bioactive zones. This led us to fusing our enzymes to Carbohydrate Binding Domains (CBDs) to ensure the enzymes would stick to the paper.

CBDs are proteins that recognise and bind specifically to polysaccharides, such as cellulose (5). Their advantages include: the fact that they are independent folding units, having inexpensive and abundant attachment matrices and, most importantly, having controllable binding affinities (6). This means that we can make sure enzymes that work at different speeds are fused to the CBD with an appropriate binding affinity in order to give the optimal concentration of enzyme on paper.

RFC10 vs RFC25

One of the goals of our biosensor is to make it a proof of concept for future biosensors with interchangeable parts. This requires us to think about how every enzyme and CBD can be exchanged for a different enzyme or CBD. This standardisation was started with the BioBrick assembly method, such that every part has complementary terminals. The original BioBrick assembly method (RFC10), however, does not allow for the construction of protein fusions, as there is an 8-nucleotide scar between the two genes leaving a frameshift mutation (7).

This led us to use the Freiburg format of RFC25 since everything we did relied on protein fusions. RFC25 is compatible with all existing parts in RFC10 and only leaves a 6-nucleotide scar, which allows the genes to stay in frame. The prefix is
GAATTCGCGGCCGCTTCTAGATGGCCGGC
containing the restriction sites EcoRI, NotI, XbaI and NgoMIV and the suffix is
ACCGGTTAATACTAGTAGCGGCCGCTGCAG
containing the restriction sites AgeI, SpeI, NotI and PstI (8). This meant that our protein-coding genes could be in frame in a single plasmid so they will produce fused, functional proteins when transcribed.

Freeze drying

The final step in creating our biosensor is ensuring its mobility. This is done by freeze-drying all of the enzymes on paper. This process increases stability and shelf-life of enzymes so that freshness, and therefore reliability, of the biosensors is not compromised. It further involves freezing the sample, as well as two subsequent stages of drying (9). Freeze-drying with 20% trehalose is a method of further increasing the stability of the enzymes (10).

An adaptable design

Whilst Edinburgh iGEM 2015’s biosensor may leave a great legacy in improving drug safety, we hope the impact it has does not end there. Our biosensor is a fluid and adaptable model that can be easily manipulated to serve a range of analytical purposes, bringing synthetic biology to the forefront of detection sciences.

Through exchange of standard biological parts, the device can easily be produced with different enzymes by switching the genes in our backbone. This allows our biosensor to be important not only as a harm reduction tool for drug users, but as a proof of concept with much wider applications. Exchanging the enzymes in the biosensor could allow for our device to test for a multitude of compounds, be they drugs, contaminants or counterfeit-pharmaceuticals. (Find out more in Future Applications- link to future applications).

Our device is far more than a tool to improve the safety of a small group of user; its user-targeted design and enhanced biosafety allows our biosensor to bring synthetic biology out of the lab and into society in ways that have not been possible before.

References

1. Pelton, R. (2009) Bioactive Paper Provides Low Cost Platform for Diagnostics. Trends in Analytical Chemistry, 28(8), 925-942. 2. Chart, H., Smith, H. R., La Ragione, R. M., & Woodward, M. J. (2000). An investigation into the pathogenic properties of Escherichia coli strains BLR, BL21, DH5α and EQ1. Journal of applied microbiology, 89(6), 1048-1058. 3. K.S. Matthews, J.C. Nichols (1998). Lactose repressor protein: functional properties and structure. Prog Nucleic Acid Res Mol Biol, 58, 127–164 4. O'Connor, C. D., & Timmis, K. N. (1987). Highly repressible expression system for cloning genes that specify potentially toxic proteins. Journal of bacteriology, 169(10), 4457-4462. 5. Boraston, A. B., Bolam, D., Gilbert, H., & Davies, G. J. G. J. (2004). Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem. J, 382, 769-781. 6. Bayer, E. A., Morag, E., & Lamed, R. (1994). The cellulosome—a treasure-trove for biotechnology. Trends in biotechnology, 12(9), 379-386. 7. Anderson, J., Dueber, J. E., Leguia, M., Wu, G. C., Goler, J. A., Arkin, A. P., & Keasling, J. D. (2010). BglBricks: A flexible standard for biological part assembly. Journal of biological engineering, 4(1), 1-12. 8. Grünberg, R., Ferrar, T. S., van der Sloot, A. M., Constante, M., & Serrano, L. (2010). Building blocks for protein interaction devices. Nucleic acids research, gkq152. 9. Roy, I., & Gupta, M. N. (2004). Freeze‐drying of proteins: some emerging concerns. Biotechnology and applied biochemistry, 39(2), 165-177. 10. Mazzobre, M. F., & Buera, M. D. P. (1999). Combined effects of trehalose and cations on the thermal resistance of β-galactosidase in freeze-dried systems. Biochimica Et Biophysica Acta (BBA)-General Subjects, 1473(2), 337-344.