Difference between revisions of "Team:Glasgow/Part Collection"
| Line 301: | Line 301: | ||
</br> | </br> | ||
</br> | </br> | ||
| − | |||
| + | <h1>B0032-derived RBS library members</h1> | ||
<center> | <center> | ||
<img src="https://static.igem.org/mediawiki/2015/d/d9/RBS-LIBRARY-PARTS.jpg"> | <img src="https://static.igem.org/mediawiki/2015/d/d9/RBS-LIBRARY-PARTS.jpg"> | ||
| Line 316: | Line 316: | ||
<p class="mainText" style="text-align:center;"> | <p class="mainText" style="text-align:center;"> | ||
Randomised sequence locations are shown in red. Estimated strength corresponds to the Translation Initiation Rate values predicted by <a href="https://www.denovodna.com/" target="_blank">RBS library calculatorfor</a> <i>luxA</i> gene. | Randomised sequence locations are shown in red. Estimated strength corresponds to the Translation Initiation Rate values predicted by <a href="https://www.denovodna.com/" target="_blank">RBS library calculatorfor</a> <i>luxA</i> gene. | ||
| + | </p> | ||
| + | |||
| + | <h1>Obtaining parts</h1> | ||
| + | <p class="mainText" style="text-align:center;"> | ||
| + | RBS library parts are not submitted to the registry. For obtaining physical DNA of a particular RBS sequence or of the whole RBS library we offer de novo synthesis by PCR. | ||
| + | </br> | ||
| + | Primer sequence for obtaining RBS library for a specific gene: | ||
| + | </br> | ||
| + | aaataa<div style="color:blue;">GAATTCGCGGCCGCTTCTAGAG</div><div style="color:red">TCACACANRARRG</div><div style="color:green;">TACTAG</div>ATG | ||
| + | </br> | ||
| + | random sequence--biobrick prefix--RBS degenerate sequence--RBS scar--start codon | ||
| + | |||
</p> | </p> | ||
Revision as of 22:11, 18 September 2015
Part Collection
Home > Basic Part > Part Collection
RBS library parts K1725301-K1725332
Parts K1725301-K1725332 are members of ribosome binding site library derived from Anderson-family RBS B0032 (BBa_B0032). All 32 sequences were obtained by randomised PCR.
Design
For the construction of the RBS library, a master sequence based on the RBS B0032 was used. 4 nucleotides within the actual ribosome binding site were randomised giving 32 different B0032-derived RBS variants. The predicted efficiency of each RBS library member was estimated using RBS Library Calculator. Originally, RBS Library was designed for every gene in luxABGCDE operon (BBa_K1725352) in order to optimise bioluminescence in E. coli. 32 different BioBrick RBS variants were incorporated upstream of each of the lux genes by PCR, and different libraries were then combined together by BioBrick assembly. This method could potentially produce over 1 billion different variants of the lux operon. The developed method was relatively quick, and could easily be used to optimize other metabolic pathways where a suitable screen or selection for optimal performance is available.
B0032-derived RBS library members
Randomised sequence locations are shown in red. Estimated strength corresponds to the Translation Initiation Rate values predicted by RBS library calculatorfor luxA gene.
Obtaining parts
RBS library parts are not submitted to the registry. For obtaining physical DNA of a particular RBS sequence or of the whole RBS library we offer de novo synthesis by PCR. Primer sequence for obtaining RBS library for a specific gene: aaataa