gh

Description

A Cell-free, Paper-based Biosensor

The utilization of a cell-free system was the most appropriate choice for this project, for it was conducive to the biosensor being used outside of the laboratory in a safe and effective manner. Indeed, it is paramount that users of the biosensor are not exposed to potential pathogens, and that that the environment is protected against the accidental release of genetically modified organisms. Since our device is intended to be used primarily by people with little or no training, the best way to provide this level of safety and security was to ensure that no live organisms were incorporated in the test.

Avoiding the use of live organisms also allows for a degree of portability, for regulation would have otherwise hindered the implementation in non-laboratory environments, including the environments in which we intend to employ the device (see p&p for more - link to our story). Furthermore, there would be a long and costly legal process to get our biosensor the green light if it were to utilize genetically modified organisms.

The choice of a paper-based biosensor was also fundamental to its ability to compete on the free market, as this reduced the estimated cost to no more than 10 pence per test paper (1).

Enzymes or Genes?

In the earliest stages of design, we contemplated using gene networks to operate our detection system; however, our human practices research quickly led us to re-evaluate this decision. Through conversations with our end users, as well as professionals working directly with the users (see p&p- link to our story), we quickly learnt that users would be seriously deterred from using the sensor if they were subjected to long waiting-times for results. Thus, it became clear that minimising time-to-detection was a priority for our design, and that using an enzyme system, with its increased speed of detection and stability compared to gene networks, was the best method to meet this criteria.

Producing the Enzymes

In order to decrease the cost of the biosensor, we decided not to purify the enzymes, because this is both a tedious and expensive process. Instead, we will place crude cell lysate on each of the bioactive zones. By transforming the plasmids in the chassis Escherichia coli BL21 (DE3), we can increase enzyme production. This is a result of it being a robust and non-pathogenic E. coli B strain able to grow vigorously in minimal media in comparison to the Top10s we completed our cloning in. It is also deficient in ompT and lon; two proteases that could cause problems with protein isolation (2).

All protein expression is under the control of the lactose induced expression cassette (BBa_K314103) produced by iGEM10_Washington. This expression cassette includes a LacI generator and a lactose inducible promoter with the Elowitz standard RBS. By putting the lac operon in front of the enzyme coding sequence, we should be able to regulate transcription of the gene via production of the LacI repressor protein. IPTG, an analogue of lactose, can be used to induce protein expression (3). Having a repressible promoter is key in situations where the proteins can be toxic to the cells in high concentrations (4).

Immobilising the Enzymes

After considering the large amount of diffusion of the crude cell lysate through the paper, we thought about methods to immobilise the enzymes so they remain in the intended bioactive zones. This led us to fusing our enzymes to Carbohydrate Binding Domains (CBDs) to ensure the enzymes would stick to the paper.

CBDs are proteins that recognise and bind specifically to polysaccharides, such as cellulose (5). Their advantages include: the fact that they are independent folding units, having inexpensive and abundant attachment matrices and, most importantly, having controllable binding affinities (6). This means that we can make sure enzymes that work at different speeds are fused to the CBD with an appropriate binding affinity in order to give the optimal concentration of enzyme on paper.

RFC10 vs RFC25

One of the goals of our biosensor is to make it a proof of concept for future biosensors with interchangeable parts. This requires us to think about how every enzyme and CBD can be exchanged for a different enzyme or CBD. This standardisation was started with the BioBrick assembly method, such that every part has complementary terminals. The original BioBrick assembly method (RFC10), however, does not allow for the construction of protein fusions, as there is an 8-nucleotide scar between the two genes leaving a frameshift mutation (7).

This led us to use the Freiburg format of RFC25 since everything we did relied on protein fusions. RFC25 is compatible with all existing parts in RFC10 and only leaves a 6-nucleotide scar, which allows the genes to stay in frame. The prefix is
GAATTCGCGGCCGCTTCTAGATGGCCGGC
containing the restriction sites EcoRI, NotI, XbaI and NgoMIV and the suffix is
ACCGGTTAATACTAGTAGCGGCCGCTGCAG
containing the restriction sites AgeI, SpeI, NotI and PstI (8). This meant that our protein-coding genes could be in frame in a single plasmid so they will produce fused, functional proteins when transcribed.

Freeze drying

The final step in creating our biosensor is ensuring its mobility. This is done by freeze-drying all of the enzymes on paper. This process increases stability and shelf-life of enzymes so that freshness, and therefore reliability, of the biosensors is not compromised. It further involves freezing the sample, as well as two subsequent stages of drying (9). Freeze-drying with 20% trehalose is a method of further increasing the stability of the enzymes (10).

Team:Edinburgh/Description