Team:UCLA/Notebook/Interlab Study/12 August 2015
Arrival of gBlocks for all three devices
- All three devices ordered as gBlocks arrived today! Refer to main lab notebook page for details regarding device specifications and FASTA sequence verification.
- All three devices were briefly spun for 3-5 seconds at 3,000xg to ensure all DNA is at bottom of tube, resuspended in 100 uL of TE buffer, and briefly vortexed to mix. Tubes were then incubated at 50 degrees Celsius for 20 minutes to ensure elution of the total DNA, and briefly vortexed and centrifuged to homogenize and collect the samples.
- gBlocks must be amplified before digestion to ligate into pSB1C3. A set of primers were prepared and ordered via IDT to amplify all three devices based on the Prefix and Suffix sites.
Amplification Primers for all Interlab Devices
Primers created are as follows, with parameters of each primer individually and as a pair calculated via Benchling.
Forward: 5' ATGCATGCGAATTCGCGGCC 3' Tm: 62.5 GC%: 60 20bp
Reverse: 5' CGGCCGCTGCAGATGCAT 3' Tm: 61.7 GC%: 66.67 18bp
deltaTm: 0.79 deg Primer Dimer: -9 deltaG Product Size Est: 975bp. Leaves enough room for restriction site handles for optimal digestion.