Overview

TO WIKI PEOPLE : This should be split in two columns like this : Overview || Key Achievements

Key Achievements

1. Key Achievement #1
2. Key Achievement #2

Introduction:Yeast pheromone pathway

text

Yeast Saccharomyces cerevisiae exists either in haploid or diploid state. The two mating types are called MATa and MATα and differ only within approx. 2 kbp long region on chromosome III called MAT locus. MATa locus expresses transcription factors a1 and a2, whereas MATα locus expresses transcription factors α1 and α2. Both types express three groups of genes, which are:

• haploid-specific genes (h-sg)
• a-specific genes (a-sg)
• α-specific genes (α-sg

As their names indicate, these genes are only active in haploids, MATa cells, or MATα cells, respectively.

Both mating types constantly produce small amounts of mating type-specific pheromone and when the two cells of opposite types are in close proximity they identify each other by sensing each other’s pheromone. The response to detected pheromone is facilitated by so called pheromone pathway, which is a cascade of chemical reactions that results in the preparation for mating. Since only haploids mate, the yeast pheromone pathway is only functional in haploid cells.

Design: Reconstruction of yeast pheromone pathway in diploid cell

text

The schematic shows that h-sg genes are switched-off in diploid cell and since all genes included in yeast pheromone pathway signal transduction (except from the pheromone receptor)are h-sg, the pathway can be reconstructed by switching them on. It can be managed by interrupting one of the h-sg regulators - a1 or α2. While a1 has no function in haploid, its deletion has no effect in haploid cell, but in diploid it interrupts the repression of h-sg.

Hello wiki people

Naturally in haploids, after exposure to mating pheromone yeast pheromone pathway results in induction of expression of mating genes that initiate the mating process. Since it is not desired for the synthetic diploid to mate, the initiation of mating process needs to be disrupted. It can be achieved by repressing Ste12 transcription in the diploid. While Ste12 is fundamental in both haploid types in the process of mating, the designed mechanism must preserve transcription in haploid cells and repress it in diploid.

For this purpose, mechanism of tetracycline-controlled transcriptional activation was used: a1 gene in MATa was replaced by TetR and STE12 was put under the control of synthetic a-specific promoter that is repressed in the same way as a-sg. In MATα, α1 repression was preserved by placing it under the control of pTet and STE12 was also put under the control of pTet. As a result, transcription of Ste12 is preserved in both haploids and repressed in diploid - pTet-STE12 thanks to TetR repressor that is expressed from MATa chromosome, and a-specific STE12 thanks to α2. Also h-sgare expressed because of disruptedrepression by deleting a1 preserving transcription of all the genes forming yeast pheromone pathway.

See following pages for detailed information about constructing the synthetic haploids:

• MATα
• MATa

Concept

DNA

Materials and methods

Chemicals and strains

Protocols

Construction

Construction of reporter plasmids

The pADH1, pSTE2, pSTE5, and pFUS1 promoters were obtained by PCR from yeast genome (isolated according to standard protocol from 7283 MATx strain). The asCYC1 and pTv3 promoters were obtained by PCR from g-blocks. The primers used for this are as follows :

The asCYC1, and pTv3 promoters were obtained by PCR from g-blocks The primers used for this are as follows

Forward: TACTAGTAGCGGCCGCTGCAG Reverse: GCTAGCCCAAAAAAACGGGTATGGAG

All promoters were PCRed in a single PCR run, with the following conditions . PCR products were gel verified

INSERT PHOTO_1

PCR products were then purified () and restricted by corresponding restriction enzymes, which are listed in the following table

INSERT TABLE

Construction of INSERT MATa and INSERT MATx

The backbone pRSII406 was obtained from Addgene. MATa was ordered in the form of gblock yG_MATa with sequence

AATTCATCTAGAGAAGAAAGCAAAGCCTTAATTCCAAGGAAAAAGAAGAAGTTGCAAAGAAATGTGGCATTACTCCACTTCAAGTAAGAGTTTGGGTATGTAATATGAGAATCAAACTTAAATATATCCTATACGTAGTATGGCGGAAAACATAAACAGAACTCTGTTTAACATTCTAGGTACTGAGcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaatCTAAAATTCCCGGGATCCGCTGTACGCGGACCCACTTTCACATTTAAGTTGTTTTTCTAATCCGCATATGATCAATTCAAGGCCGAATAAGAAGGCTGGCTCTGCACCTTGGTGATCAAATAATTCGATAGCTTGTCGTAATAATGGCGGCATACTATCAGTAGTAGGTGTTTCCCTTTCTTCTTTAGCGACTTGATGCTCTTGATCTTCCAATACGCAACCTAAAGTAAAATGCCCCACAGCGCTGAGTGCATATAATGCATTCTCTAGTGAAAAACCTTGTTGGCATAAAAAGGCTAATTGATTTTCGAGAGTTTCATACTGTTTTTCTGTAGGCCGTGTACCTAAATGTACTTTTGCTCCATCGCGATGACTTAGTAAAGCACATCTAAAACTTTTAGCGTTATTGCGTAAAAAATCTTGCCAGCTTTCCCCTTCTAAAGGGCAAAAGTGAGTATGGTGCCTATCTAACATTTTAATAAGTTGATTGTATGCTTGGTATAGCTTGAAATATTGTGCAGAAAAAGAAACAAGGAAGAAAGGGAACGAGAACAATGACGAGGAAACAAAAGATTAATAATTGCAGGTCTATTTATACTTGATAGCAAGACAGCAAACTTTTTTTTATTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGAGAGTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGCTTCGAGATACCCCTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAATTTTTTCCTTTAGTGTCTTCCATCATTTTTTTGTCATTGCGGATATGGTGAGACAACAACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGtaaacccacaccgggtgtcataatcaaccaatcgtaacttcatctcttccacccatgtctctttgagcaataaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagtacccttagtatattctccagtagatagggagcccttgcatgacaattctgctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaaaccgctaacaatacctggTccACTAGTCCCGGGAGCAAGATCAAGATGTTTTCACCGATCTTTCCGGTCTCTTTGGCCGGGGTTTACGGACGATGGCAGAAGACCAAAGCGCCAGTTCATTTGGCGAGCGTTGGTTGGTGGATCAAGCCCACGCGTAGGCAATCCTCGCAGATCTCGAACCATGTAATTTCCGAATACGGTAATTACACGCATCGAGCAGATCCGCCAGGCGTGTATATATAGCGTGGATGGCCAGGCAACTTTAGTGCTGACACATACAGGCATATATATATGTGTGCGACGACACATGATCATATGGCATGCATGTGCTCTGTATGTATATAAAACTCTTGTTTTCTTCTTTTCTCTAAATATTCTTTCCTTATACATTAGGACCTTTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAAaagctt

MATx was ordered in the form of two g-blocks, yG_MATx1 and yG_MATx2

yG_MATx1 :

AAGCTTGGATTCTCACAATCCTGTCGGTCACTTCTCGGCTGTTCGCGTATATTTTTTGTTGATACTTTTACCGGTATTTTGTCTGTAATTTATTCTCTATCACTGATAGGGACTTCTCTATCACTGATAGGGAACCCAGCCTGATTTATACTATTAGGGATCGCAGGAAGGCGGTGGGAAGTCCGGGAGTCGCTGAGGGGAAGTGTCAGTGGTTTTGGGTATAAATGGCTGGTTGTTCCCTATCAGTAATAGAGAATTCCCTATCAGTGATAGAGACTGCGGATTTAGAAACTACCTGATAAAAGTATCAACAAAAATTGCGCATGCCGGCCTGGATTTTGCGCAAATTTACCTTAACGTCCCACAATATGTTTACTTCGAAGCCTGCTTTCAAAATTAAGAACAAAGCATCCAAATCATACAGAAACACAGCGGTTTCAAAAAAGCTGAAAGAAAAACGTCTAGCTGAGCATGTGAGGCCAAGCTGCTTCAATATTATTCGACCACTCAAGAAAGATATCCAGATTCCTGTTCCTTCCTCTCGATTTTTAAATAAAATCCAAATTCACAGGATAGCGTCTGGAAGTCAAAATACTCAGTTTCGACAGTTCAATAAGACATCTATAAAATCTTCAAAGAAATATTTAAACTCATTTATGGCTTTTAGAGCATATTACTCACAGTTTGGCTCCGGTGTAAAACAAAATGTCTTGTCTTCTCTGCTCGCTGAAGAATGGCACGCGGACAAAATGCAGCACGGAATATGGGACTACTTCGCGCAACAGTATAATTTTATAAACCCTGGTTTTGGTTTTGTAGAGTGGTTGACGAATAATTATGCTGAAGTACGTGGTGACGGATATTGGGAAGATGTGTTTGTACATTTGGCCTTATAGAGTGTGGTCGTGGCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTATCCTATTTGAAACTCCCCATCGTCTTGCTGCAG

yG_MATx2 :

CTGCAGAGTAGTGTCTGAGGTACAAACATCTTAGTAGTGTCGAGAGGGTTGATTGTTTATGTATTTTTGCGAAATATATATATATATATTCTACACAGATATATACATATTTGTTTTTCGGGCTCATTCTTTCTTCTTTGCCAGAGGCTCACCGCTCAAGAGGTCCGCTAATTCTGGAGCGATTGTTATTGTTTTTTCTTTTCTTCTTCTATTCGAAACCCAGTTTTTGATTTGAATGCGAGATAAACTGGTATTCTTCATTAGATTCTCTAGGCCCTTGGTATCTAGATATGGGTTCTCGATGTTCTTTGCAAACCAACTTTCTAGTATTCGGACATTTTCTTTTGTAAACCGGTGTCCTCTGTAAGGTTTAGTACTTTTGTTTATCATATCTTGAGTTACCACATTAAATACCAACCCATCCGCCGATTTATTTTTCTGTGTAAGTTGATAATTACTTCTATCGTTTTCTATGCTGCGCATTTCTTTGAGTAATACAGTAATGGTAGTAGTGAGTTGAGATGTTGTTTGCAACAACTTCTTCTCCTCATCACTAATCTTACGGTTTTTGTTGGCCCTAGATAAGAATCCTAATATATCCCTTAATTCAACTTCTTCTTCTGTTGTTACACTCTCTGGTAACTTAGGTAAATTACAGCAAATAGAAAAGAGCTTTTTATTTATGTCTAGTATGCTGGATTTAAACTCATCTGTGATTTGTGGATTTAAAAGGTCTTTAATGGGTATTTTATTCATTTTTTCTTAGTGTGTGTATTTGTATTTGCGTGTCTATAGAAGTATAGTAATTTATGCTGCAAAGGTCCTAATGTATAAGGAAAAAAAATTTAGAGAAAAAAAGAAAAAAAGAGTTTTATATACATACAGAGCACATACATGCCATATAATCATGTATATACGCGCACATATATATATGCCTGTATGTGTCAGCACTAAATTTACCTGAACATACGCGCTATATATACGCGCCTCGCGTATATGCTCGAGGATTCCCTACGCGTGGGCTTTTTTTACTAACCAACGCGCGCGAAATActagt

The g-blocks were restricted by the following enzymes, along with the vector

insert table 1

Restriction were purified (insert purification kit name) and ligated together using the standard ligation protocol. STE12 was PCR amplified from yeast genome (isolated from 7283 MATx strain) using the following primers : Forward : CTTGTAAAGCTTCCAAGGATGAAAGTCCAAATAACCAATAGTAGAACA Reverse : ACTGCACTCGAGAGATTTGTTACATTTATTACCTTTTTTTCTTGCTTT The conditions for the PCR were the following

Results

Final constructs

Herein we should describe the final constructs we have obtained, and add verification gels etc.

Test of mating types

Appendix

Personnel

Tereza Puchrová - The leading scientist

Hynek Kasl - The helping hand

Anna Sosnová - The actual worker

Václav Pelíšek - The parafilmer of plates

Useful Links

Protocols page:

Protocols

References

1. ↑ Lin, C.-H., Choi, a., & Bennett, R. J. (2011). Defining pheromone-receptor signaling in Candida albicans and related asexual Candida species. Molecular Biology of the Cell, 22(24), 4918–4930. doi:10.1091/mbc.E11-09-0749