Difference between revisions of "Team:Czech Republic/Project/Orthogonal signals and receptors"

(Signals)
(Receptors)
Line 239: Line 239:
 
Reaction of the WT '''a''' cells to different concentrations of the pheromone:
 
Reaction of the WT '''a''' cells to different concentrations of the pheromone:
  
[[File:Czech_Republic_val-aF-a.png|500px|WT ''''a'''' cells]]
+
[[File:Czech_Republic_val-aF-a.png|500px|center|WT ''''a'''' cells]]
  
 
Reaction of the alpha cells with introduced STE2 receptor to different concentrations of the pheromone:
 
Reaction of the alpha cells with introduced STE2 receptor to different concentrations of the pheromone:
  
[[File:Czech_Republic_val-aF-ste2.png|500px|WT alpha cells + STE2]]
+
[[File:Czech_Republic_val-aF-ste2.png|500px|center|WT alpha cells + STE2]]
  
 
=== Signals ===
 
=== Signals ===

Revision as of 16:52, 17 September 2015

Orthogonal signals and receptors

Abstract

In order to achieve more complex behaviour of our IODs, each IOD needs to be able to communicate with others. Since the pheromone response pathway was used for signal transduction, we prepared several synthetic signals and receptors that couple to this pathway and allow our IODs to communicate without a cross-talk.

Key Achievements

  • Constructed a set of yeast plasmids with different mating pheromones and their receptors.
  • Verified the correct coupling of the receptors to the yeast pheromone mating pathway.
  • Verified the correct expression and secretion of the different pheromones.
  • Contributed to the Registry with six BioBricks

Intro / Background

By sensing mating pheromones, S. cerevisiae cells can find their mating partners. We decided to exploit this mechanism for a communication between our IODs.

As was reported in [Janiak2005], it is possible to express chimeric STE2 receptors and couple them to the existing mating pathway. However, since each strain has differences in the G-protein that interacts with the receptor, this cpupling is not very efficient. Fortunately, as reported in [Lin2011], this efficiency can be increased by a change of the STE2 C-terminal.

We decided to test five STE2 receptors from different yeast strains. One of them with two different C-terminals to see the effects of this change on the signal transduction. For each of these receptors, we constructed a plasmid expressing the corresponding pheromone.

Design

Concept

Receptors

Alpha factor receptor (STE2) is produced and displayed by a cells. It is a 431aa long seven transmembrane-domain (TM in the figure) GPCR. Since the sequence is known, it can be easily obtained by a PCR from the genome of our Saccharomyces cerevisiae strain. For higher translation in yeast, we added consensus Kozak sequence before the start codon. Also, restriction sites were added to the ends of the fragment to allow easy future cloning.


Scheme of the STE2 ORF


Other STE2 receptors (STE2 receptors from different yeast strains) were obtained via gBlocks® order. In order to achieve effective coupling to the pheromone mating pathway in the Saccharomyces cerevisiae strain and proper expression, we performed several tasks.

Transmembrane domain prediction from ELM

First, after the initial protein [http://blast.ncbi.nlm.nih.gov/Blast.cgi BLAST] search, codon optimization was done using an online tool from IDT. During this proccess, all BioBrick restriction sites were removed from the DNA sequence.

Second, for each of the STE2 receptor, its C-terminal was replaced by the C-terminal from Candida albicans or Saccharomyces cerevisiae in order to improve coupling to the pheromone mating pathway [Lin2011]. The effect of each replacement on the protein folding was checked using the [http://elm.eu.org/ ELM resource]. Using this tool, we have verified that the changes in the C-terminal have no effect on the transmembrane domains.

Finally, the DNA sequences were optimized according to the recommendations from the IDT ordering form to speed up the synthesis process.

Signals

Alpha-factor mating pheromone is a short peptide (typically 13aa long) secreted by alpha cells. For our project, we needed to produce a variety of these pheromones and secrete them from the cells. Altough there are some secretion tags present in the registry ([http://parts.igem.org/Part:BBa_K416003 BBa_K416003], [http://parts.igem.org/Part:BBa_K792002 BBa_K792002]), there are no parts encoding pheromones available. Also, since we found evidence that the complete wild-type signal tag is needed for the proper secretion of the pheromone [Caplan1991], we decided to obtain the whole sequence directly from the MF(ALPHA)1 locus.

MF(ALPHA)1 gene codes for four mature alpha-factors within a putative precursor of 165 amino acids. This sequence begins with a signal tag for secretion and a segment with three glycosylation sites (89aa). The second segment contains four mature alpha-factors, each preceded by spacer peptides, which contain proteolytic processing signals [Kurjan1982].


Scheme of MF(ALPHA)1


Since we wanted the pheromone peptides to be easily changeable by Site-directed mutagenesis (SDM), we decided to preserve the signal tag with only one copy of the pheromone:


Scheme of the final ORF


This would create a unique site for the SDM. The final production level of the pheromone is supposed to be practically the same, since the used plasmid is present in the cell in more copies (2-5). Also, for higher expression in the cells, we added consensus Kozak sequence before the start codon. Restriction sites were added to the ends of the sequence for easy future cloning.

Materials and methods

Used strains

E. coli
  1. DH5α
S. cerevisiae
  1. 7283
  2. 7284
  3. Δbar1
  4. 6193

Used material / chemicals

  1. LB-M agar plates with ampicillin and chloramphenicol
  2. 1.5 ml eppendorf tubes
  3. 0.5 ml PCR tubes
  4. 50 ml centrifuge conical base and rim tubes
  5. NucleoSpin Plasmid DNA, RNA, and protein purification Kit
  6. NucleoSpin Gel and PCR Clean-up Kit
  7. YPD medium, SD-min medium and minimal medium with galactosidase
  8. NaOH agarose gel and buffer
  9. Synthetic alpha-factor
  10. CuSO4

Used methods

  1. Transformation
  2. Miniprep
  3. Restriction digest
  4. Ligation
  5. NucleoSpin Gel Clean-up
  6. NucleoSpin Plasmid DNA purification
  7. Flow cytometry

All used protocols can be found at the Protocols page.

Used software

  1. CFlow Plus
  2. Microsoft Excel
  3. MATLAB®

Construction

Receptors

Receptors were constructed by a restriction/ligation using pRSII416 vector. Wild-type ste2 from Saccharomyces cerevisiae was obtained by a PCR from the genome (the sequence can be found as [http://www.yeastgenome.org/locus/S000001868/overview YFL026W]), pGAL1 promoter was obtained from the Registry (part [http://parts.igem.org/Part:BBa_J63006 BBa_J63006]) and amplified with primers with different restriction sites. Other STE2 receptors were ordered as gBlocks.

First, the plasmid pGAL1_SC_WT was constructed (details can be found in our Notebook):


Scheme of the final plasmid


Then, the ste2 gene from Saccharomyces cerevisiae was replaced by the different ste2 sequences. After this cloning, we had plasmids with 6 different ste2 receptors under the pGAL1 promoter.

Also, in order to simplify future experiments, pGAL1 promoters were replaced with constitutive pADH1 promoters on all plasmids, which were later transferred on pRSII415 plasmids (with LEU marker insted of URA). This made 18 different receptors plasmids in total.

Used primers

Name Sequence
ig2-ste2p-HindIII-F tcaatgaagcttTACAAAATGTCTGATGCGGCTCCT
ig2-ste2p-BamHI-R tcagatggatccTCATAAATTATTATTATCTTCAGTCCAGAACT
ig2-pGAL1-XhoI-F tacagcctcgagCGGATTAGAAGCCGCCGAG
ig2-pGAL1-HindIII-R tcacgtaagcttCTCCTTGACGTTAAAGTATAGAGGT

Used sequences

pGAL1 amplified from [http://parts.igem.org/Part:BBa_J63006 BBa_J63006]

tacagcctcgaCGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGaagcttacgtga

pADH1 amplified from the genome

ctcgagCAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTaagctt

Saccharomyces cerevisiae STE2 with its (SC) C-terminal

tcaatgaagcttTACAAAATGTCTGATGCGGCTCCTTCATTGAGCAATCTATTTTATGATCCAACGTATAATCCTGGTCAAAGCACCATTAACTACACTTCCATATATGGGAATGGATCTACCATCACTTTCGATGAGTTGCAAGGTTTAGTTAACAGTACTGTTACTCAGGCCATTATGTTTGGTGTCAGATGTGGTGCAGCTGCTTTGACTTTGATTGTCATGTGGATGACATCGAGAAGCAGAAAAACGCCGATTTTCATTATCAACCAAGTTTCATTGTTTTTAATCATTTTGCATTCTGCACTCTATTTTAAATATTTACTGTCTAATTACTCTTCAGTGACTTACGCTCTCACCGGATTTCCTCAGTTCATCAGTAGAGGTGACGTTCATGTTTATGGTGCTACAAATATAATTCAAGTCCTTCTTGTGGCTTCTATTGAGACTTCACTGGTGTTTCAGATAAAAGTTATTTTCACAGGCGACAACTTCAAAAGGATAGGTTTGATGCTGACGTCGATATCTTTCACTTTAGGGATTGCTACAGTTACCATGTATTTTGTAAGCGCTGTTAAAGGTATGATTGTGACTTATAATGATGTTAGTGCCACCCAAGATAAATACTTCAATGCATCCACAATTTTACTTGCATCCTCAATAAACTTTATGTCATTTGTCCTGGTAGTTAAATTGATTTTAGCTATTAGATCAAGAAGATTCCTTGGTCTCAAGCAGTTCGATAGTTTCCATATTTTACTCATAATGTCATGTCAATCTTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAACAGATGTCTTGACTACTGTTGCAACATTACTTGCTGTATTGTCTTTACCATTATCATCAATGTGGGCCACGGCTGCTAATAATGCATCCAAAACAAACACAATTACTTCAGACTTTACAACATCCACAGATAGGTTTTATCCAGGCACGCTGTCTAGCTTTCAAACTGATAGTATCAACAACGATGCTAAAAGCAGTCTCAGAAGTAGATTATATGACCTATATCCTAGAAGGAAGGAAACAACATCGGATAAACATTCGGAAAGAACTTTTGTTTCTGAGACTGCAGATGATATAGAGAAAAATCAGTTTTATCAGTTGCCCACACCTACGAGTTCAAAAAATACTAGGATAGGACCGTTTGCTGATGCAAGTTACAAAGAGGGAGAAGTTGAACCCGTCGACATGTACACTCCCGATACGGCAGCTGATGAGGAAGCCAGAAAGTTCTGGACTGAAGATAATAATAATTTATGAggatccatctga

Candida albicans STE2 with its (CA) C-terminal (gBlock)

gtaaaacgacggccagtctcgagaagcttTACAAAATGAACATAAATTCTACATTCATTCCAGACAAGCCAGGGGATATCATTATTAGTTATAGTATACCGGGATTGGACCAGCCCATTCAAATACCATTCCATAGTTTAGATTCCTTTCAAACAGACCAAGCTAAGATCGCTTTAGTTATGGGTATCACAATAGGATCTTGTTCTATGACACTTATCTTTCTAATCTCAATCATGTATAAAACGAATAAGTTGACAAACTTGAAGTTGAAACTTAAGTTAAAGTACATCTTGCAATGGATCAACCAAAAGATCTTCACGAAGAAGAGAAATGATAACAAACAGCAACAACAACAGCAACAGCAACAGATTGAGAGTTCTAGTTATAACAATACTACAACGACTACTTCTGGCTCCTATAAACTTTTCCTATTCTATTTAAATTCCCTTATCCTTTTGATTGGGATTATCAGATCAGGTTGTTACCTAAATTACAATTTGGGCCCATTGAATAGCCTGTCATTTGTTTTCACTGGTTGGTATGATGGTAGTAGCTTTATTTCTAGCGATGTTACGAACGGTTTCAAATGCATTCTATATGCCTTGGTAGAAATATCTTTAGGTTTTCAAGTTTACGTAATGTTTAAAACAAGCAACTTGAAAATATGGGGTATAATGGCCAGTTTGTTGAGTATAGGCCTAGGCCTGATCGTGGTCGCGTTTCAAATCAATCTAACGATCTTGTCTCATATAAGGTTCTCTAGGGCTATCTCTACGAATAGATCCGAAGAAGAGAGCTCATTGTCTTCTGATAGCGTGGGTTATGTAATAAATAGCATTTGGATGGATCTGCCAACGATTTTATTTTCCATCAGCATAAATATCATGACAATCTTACTAATTGGTAAGCTAATCATCGCAATTAGAACAAGGAGGTACCTGGGTTTGAAACAGTTCGACTCATTTCACATCTTGTTGATTGGCTTTAGTCAAACGTTAATAATCCCGTCCATCATATTAGTTGTCCACTATTTCTATTTGTCTCAGAACAAGGATAGCTTACTTCAGCAAATTTCCTTATTGTTAATCATATTGATGTTACCGTTATCTTCATTATGGGCACAAACAGCAAACAACACCCATAATATCAACTCTTCTCCCTCACTGTCTTTTATTTCAAGGCATCATTCTTTCGACAGTTCCAGATCCGGAGGTAGTAACACTATTGTGTCCAACGGTGGTAGTAATGGTGGTGGCGGTGGTGGTGGCAACTTCCCAGTAAGTGGTATAGACGCGCAGTTACCGCCTGACATTGAGAAGATCTTACATGAAGATAATAACTATAAACTGCTTAACAGCAATAACGAGTCAGTTAACGACGGCGATATCATTATTAATGACGAGGGGATGATCACTAAGCAGATCACGATTAAAAGAGTTTAAgtcgacggatccactagtggtcatagctgtttcctg

Candida parapsilosis STE2 with CA C-terminal (gBlock)

gtaaaacgacggccagtctcgagaagcttTACAAAATGAATAAGATAGTCTCAAAACTTTCTTCTAGTGACGTTATAGTCACAGTAACCATTCCAAACGAAGAAGACGGTACTTATGAAGTACCATTCTATGCTATTGATAATTACCATTACAGTCGTATGGAGAACGCAGTGGTGTTGGGTGCCACGATTGGTGCTTGTTCTATGTTGTTAATCATGTTAATCGGGATTCTATTCAAGAATTTTCAAAGGTTAAGGAAATCTCTATTGTTCAACATAAACTTCGCAATTTTATTGATGCTAATTCTGAGATCTGCGTGTTATATTAACTATCTAATGAATAATCTGAGCTCTATATCATTCTTTTTCACCGGTATTTTTGACGATGAGTCATTCATGAGCTCCGATGCCGCAAATGCATTCAAAGTGATCTTAGTAGCATTAATTGAAGTTTCTTTAACCTACCAAATATACGTAATGTTTAAGACCCCCATGTTGAAGTCTTGGGGTATCTTTGCTAGTGTCTTAGCAGGTGTTTTAGGACTTGCAACGTTGGCAACACAAATATATACGACTGTAATGTCTCATGTAAATTTTGTGAACGGCACAACAGGTTCACCTTCACAGGTAACAAGTGCATGGATGGATATGCCAACAATCTTATTTTCTGTTTCTATTAACGTTTTATCTATGTTTTTGGTATGTAAGTTGGGTTTGGCCATTAGAACTAGAAGGTACTTAGGTTTAAAGCAATTCGATGCCTTCCATATTTTATTCATTATGTCAACTCAGACAATGATTATTCCTTCCATAATTTTGTTCGTCCATTACTTCGACCAGAATGATTCACAGACAACCTTGGTTAACATCAGTTTATTGTTAGTGGTCATTAGTTTGCCGTTAAGCTCTTTATGGGCACAAACAGCAAACAACACCCATAATATCAACTCTTCTCCCTCACTGTCTTTTATTTCAAGGCATCATTCTTTCGACAGTTCCAGATCCGGAGGTAGTAACACTATTGTGTCCAACGGTGGTAGTAATGGTGGTGGCGGTGGTGGTGGCAACTTCCCAGTAAGTGGTATAGACGCGCAGTTACCGCCTGACATTGAGAAGATCTTACATGAAGATAATAACTATAAACTGCTTAACAGCAATAACGAGTCAGTTAACGACGGCGATATCATTATTAATGACGAGGGGATGATCACTAAGCAGATCACGATTAAAAGAGTTTAAgtcgacggatccactagtggtcatagctgtttcctg

Candida parapsilosis STE2 with SC C-terminal (gBlock)

gtaaaacgacggccagtctcgagaagcttTACAAAATGAATAAGATAGTCTCAAAACTTTCTTCTAGTGACGTTATAGTCACAGTAACCATTCCAAACGAAGAAGACGGTACTTATGAAGTACCATTCTATGCTATTGATAATTACCATTACAGTCGTATGGAGAACGCAGTGGTGTTGGGTGCCACGATTGGTGCTTGTTCTATGTTGTTAATCATGTTAATCGGGATTCTATTCAAGAATTTTCAAAGGTTAAGGAAATCTCTATTGTTCAACATAAACTTCGCAATTTTATTGATGCTAATTCTGAGATCTGCGTGTTATATTAACTATCTAATGAATAATCTGAGCTCTATATCATTCTTTTTCACCGGTATTTTTGACGATGAGTCATTCATGAGCTCCGATGCCGCAAATGCATTCAAAGTGATCTTAGTAGCATTAATTGAAGTTTCTTTAACCTACCAAATATACGTAATGTTTAAGACCCCCATGTTGAAGTCTTGGGGTATCTTTGCTAGTGTCTTAGCAGGTGTTTTAGGACTTGCAACGTTGGCAACACAAATATATACGACTGTAATGTCTCATGTAAATTTTGTGAACGGCACAACAGGTTCACCTTCACAGGTAACAAGTGCATGGATGGATATGCCAACAATCTTATTTTCTGTTTCTATTAACGTTTTATCTATGTTTTTGGTATGTAAGTTGGGTTTGGCCATTAGAACTAGAAGGTACTTAGGTTTAAAGCAATTCGATGCCTTCCATATTTTATTCATTATGTCAACTCAGACAATGATTATTCCTTCCATAATTTTGTTCGTCCATTACTTCGACCAGAATGATTCACAGACAACCTTGGTTAACATCAGTTTATTGTTAGTGGTCATTAGTTTGCCGTTAAGCTCTTTATGGGCCACGGCTGCTAATAATGCATCCAAAACAAACACAATTACTTCAGACTTTACAACATCCACAGATAGGTTTTATCCAGGCACGCTGTCTAGCTTTCAAACTGATAGTATCAACAACGATGCTAAAAGCAGTCTCAGAAGTAGATTATATGACCTATATCCTAGAAGGAAGGAAACAACATCGGATAAACATTCGGAAAGAACTTTTGTTTCTGAGACTGCAGATGATATAGAGAAAAATCAGTTTTATCAGTTGCCCACACCTACGAGTTCAAAAAATACTAGGATAGGACCGTTTGCTGATGCAAGTTACAAAGAGGGAGAAGTTGAACCCGTTGACATGTACACTCCCGATACGGCAGCTGATGAGGAAGCCAGAAAGTTCTGGACTGAGGATAATAATAATTTATGAgtcgacggatccactagtggtcatagctgtttcctg

Candida tropicalis STE2 with CA C-terminal (gBlock)

gtaaaacgacggccagtctcgagaagcttTACAAAATGGACATTAATAACACGATTCAATCTTCCGGCGATATAATCATAACATATACTATTCCAGGTATAGAAGAACCTTTTGAACTACCCTTTGAAGTCTTGAACCATTTTCAATCTGAGCAGTCCAAAAACTGTTTGGTTATGGGAGTTATGATAGGTTCTTGCTCAGTTTTGCTTATCTTCCTGGTAGGGATCTTATTCAAGACTAATAAGTTCTCCACCATAGGTAAGAGTAAGAACTTGTCAAAGAACTTTCTTTTCTATTTGAATTGCTTGATAACATTCATAGGTATTATCAGAGCTGCGTGCTTTTCCAACTATCTTTTAGGCCCATTAAATTCCGCCAGTTTTGCCTTTACAGGCTGGTATAATGGTGAATCTTATGCTAGTTCTGAAGCTGCTAACGGTTTCCGTGTTATCTTGTTCGCATTAATTGAGACTTCAATGGTTTTTCAGGTTTTTGTAATGTTCAGGGGTGCTGGCATGAAAAAACTGGCATATTCCGTGACTATACTGTGTACTGCTTTGGCTTTAGTGGTTGTGGGTTTCCAAATTAATTCAGCTGTTCTTTCTCACAGAAGGTTTGTCAACACCGTTAATGAAATTGGTGACACTGGCTTGTCTTCTATTTGGCTTGATCTACCGACCATACTATTTAGCGTATCTGTCAATTTAATGTCTGTACTTTTGATTGGCAAGTTGATTATGGCAATAAAAACCAGAAGGTATTTGGGTCTAAAACAATTTGACAGCTTCCATGTTCTACTGATTTGCAGCACACAAACCCTTTTGGTGCCTAGTTTGATATTGTTCGTACATTACTTCCTATTTTTTAGAAATGCAAATGTGATGCTGATCAATATTTCCATTTTACTTATTGTTTTGATGCTGCCTTTTTCAAGTCTGTGGGCACAAACAGCAAACAACACCCATAATATCAACTCTTCTCCCTCACTGTCTTTTATTTCAAGGCATCATTCTTTCGACAGTTCCAGATCCGGAGGTAGTAACACTATTGTGTCCAACGGTGGTAGTAATGGTGGTGGCGGTGGTGGTGGCAACTTCCCAGTAAGTGGTATAGACGCGCAGTTACCGCCTGACATTGAGAAGATCTTACATGAAGATAATAACTATAAACTGCTTAACAGCAATAACGAGTCAGTTAACGACGGCGATATCATTATTAATGACGAGGGGATGATCACTAAGCAGATCACGATTAAAAGAGTTTAAgtcgacggatccactagtggtcatagctgtttcctg

Lodderomyces elongisporus STE2 with SC C-terminal (gBlock)

gtaaaacgacggccagtctcgagaagcttTACAAAATGGATGAAGCAATAAATGCCAATCTGGTCTCCGGGGATATCATTGTTTCATTCAATATACCTGGATTACCAGAGCCTGTTCAAGTGCCATTTTCAGAGTTCGACTCCTTTCATAAGGATCAATTGATTGGAGTTATTATATTAGGCGTCACTATCGGTGCTTGCTCTTTGTTGTTAATACTATTGCTTGGAATGTTGTATAAGTCACGTGAAAAGTATTGGAAGAGCTTATTGTTTATGTTGAATGTTTGTATACTTGCCGCGACAATCTTACGTTCTGGTTGCTTTTTGGATTATTATTTGTCTGATCTAGCTTCTATCAGTTATACCTTTACCGGTGTTTATAACGGCACAAGTTTTGCAAGTAGTGATGCAGCCAATGTTTTCAAGACTATTATGTTTGCACTAATAGAGACGAGTTTGACCTTTCAAGTTTATGTTATGTTCCAAGGCACCACATGGAAGAACTGGGGACATGCAGTAACCGCATTGTCCGGTTTGTTGTCAGTCGCGTCAGTAGCATTCCAGATATATACTACTATATTAAGTCACAATAACTTCAACGCAACAATTTCAGGGACTGGTACTTTAACATCTGGGGTGTGGATGGACCTGCCAACTTTACTATTTGCTGCATCAATCAATTTTATGACTATCCTACTGCTATTCAAACTTGGCATGGCTATCAGACAAAGGAGATACTTAGGTTTGAAACAGTTTGATGGCTTTCACATCCTTTTTATTATGTTTACGCAGACCTTATTTATTCCCTCTATCTTATTGGTGATCCATTATTTTTATCAAGCTATGTCTGGTCCATTCATCATAAACATGGCCCTGTTCCTTGTGGTAGCCTTCTTGCCATTGTCATCATTGTGGGCCACGGCTGCTAATAATGCATCCAAAACAAACACAATTACTTCAGACTTTACAACATCCACAGATAGGTTTTATCCAGGCACGCTGTCTAGCTTTCAAACTGATAGTATCAACAACGATGCTAAAAGCAGTCTCAGAAGTAGATTATATGACCTATATCCTAGAAGGAAGGAAACAACATCGGATAAACATTCGGAAAGAACTTTTGTTTCTGAGACTGCAGATGATATAGAGAAAAATCAGTTTTATCAGTTGCCCACACCTACGAGTTCAAAAAATACTAGGATAGGACCGTTTGCTGATGCAAGTTACAAAGAGGGAGAAGTTGAACCCGTTGACATGTACACTCCCGATACGGCAGCTGATGAGGAAGCCAGAAAGTTCTGGACTGAGGATAATAATAATTTATGAgtcgacggatccactagtggtcatagctgtttcctg

Signals

Plasmids with pheromones were constructed by a restriction/ligation using pRSII416 vector. Wild-type alpha factor from Saccharomyces cerevisiae was obtained by a PCR from the genome (MF(ALPHA)1 locus - [http://www.yeastgenome.org/locus/mf%28alpha%291/overview YPL187W]).

We couldn't design the reverse primer for the whole sequence (secretion tag + alpha factor) because of the repeating pheromone sequences. To solve this situation, we firstly amplified only the secretion tag. Using a Band-stab PCR, we added the actual pheromone, stop codon and a restriction site (as a part of the new reverse primer). The pCUP1 promoter was obtained from our laboratory depository.

First, the plasmid pCUP1_SC_alpha was constructed (details can be found in our Notebook):

Scheme of the final plasmid

After that, plasmids with other pheromones were constructed using site-directed mutagenesis.

Used sequences

pCUP1

ctcgagAGATCCCATTACCGACATTTGGGCGCTATACGTGCATATGTTCATGTATGTATCTGTATTTAAAACACTTTTGTATTATTTTTCCTCATATATGTGTATAGGTTTATACGGATGATTTAATTATTACTTCACCACCCTTTATTTCAGGCTGATATCTTAGCCTTGTTACTAGTTAGAAAAAGACATTTTTGCTGTCAGTCACTGTCAAGAGATTCTTTTGCTGGCATTTCTTCTAGAAGCAAAAAGAGCGATGCGTCTTTTCCGCTGAACCGTTCCAGCAAAAAAGACTACCAACGCAATATGGATTGTCAGAATCATATAAAAGAGAAGCAAATAACTCCTTGTCTTGTATCAATTGCATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATAGATATTAAGAAAAACAAACTGTAACGAATTGGGATCCgtcgac

Secretion tag + alpha factor

gtcgacTACAAAATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTTAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTTTGGATAAAAGAGAGGCTGAAGCTTGGCATTGGTTGCAACTAAAACCTGGCCAACCAATGTACTAAgaattc


Used primers

Name Sequence
ig2-AlphaP-CA-F ggatatttcgaacctggttaagaattcGGAGCTCCAGCTTTTGTTCCC
ig2-AlphaP-CA-R aaaatttgttaaacggaagccAGCTTCAGCCTCTCTTTTATCCAAAG
ig2-AlphaP-CP-F ggttactatgaaccacagtaagaattcGGAGCTCCAGCTTTTGTTCCC
ig2-AlphaP-CP-R gtaggttgtccaatgaggcttAGCTTCAGCCTCTCTTTTATCCAAAG
ig2-AlphaP-CT-F atatggatggttttctccaaactaagaattcGGAGCTCCAGCTTTTGTTCCC
ig2-AlphaP-CT-R ctggttaatctgaatttgaatttggcAGCTTCAGCCTCTCTTTTATCCAAAG
ig2-AlphaP-LE-F ggaaggtttagtcctgtttaagaattcGGAGCTCCAGCTTTTGTTCCC
ig2-AlphaP-LE-R atatcttgtccacatccaaccAGCTTCAGCCTCTCTTTTATCCAAAG

Pheromones

Name Sequence
Saccharomyces cerevisiae TGGCATTGGTTGCAACTAAAACCTGGCCAACCAATGTAC
Candida albicans GGCTTCCGTTTAACAAATTTTGGATATTTCGAACCTGGT
Candida parapsilosis AAGCCTCATTGGACAACCTACGGTTACTATGAACCACAG
Candida tropicalis GCCAAATTCAAATTCAGATTAACCAGATATGGATGGTTTTCTCCAAAC
Lodderomyces elongisporus GGTTGGATGTGGACAAGATATGGAAGGTTTAGTCCTGTT

Validation

Receptors

Wild-type a cells (7284) and alpha cells with pRSII416_pGAL1_STE2 were grown in minimal media with galactosidase overnight. At time t=0, cultures were diluted and different concentrations of the synthetic alpha pheromone were added (0, 50, 100, 150 and 200μM). In the ideal case, alpha cells with introduced STE2 receptor should exhibit similar behavior as WT a cells - growth arrest in the presence of the pheromone.

Reaction of the WT a cells to different concentrations of the pheromone:

WT 'a' cells

Reaction of the alpha cells with introduced STE2 receptor to different concentrations of the pheromone:

WT alpha cells + STE2

Signals

Wild-type a cells (7284) , cells with pRSII416_pGAL1_STE2, cells with pCUP1_SC_Alpha and wild-type alpha cells (7283) were grown overnight in SD min.

In the morning, cultures 7283, 7284 and pRSII416_pGAL1_STE2 were diluted in the same medium and incubated for 6 hours. Culture pCUP1_SC_Alpha was centrifuged (3000g) and resuspended in SG-min (minimal medium with galactose) supplemented with 0.1μM CuSO4.

Alpha factors for induction were obtained by centrifugation of 7283 (aF83) and pCUP1_SC_Alpha (aF) cultures at 3000g and removing the cell pellet. Obtained supernatant was combined with a and pRSII416_pGAL1_STE2 cells (20μL culture + 80μL media).

First, reaction of the a cells in the medium with WT alpha factor and the alpha factor produced by our a cells transformed with pCUP1_SC_Alpha was determined:

'a' cells response

The a cells without any pheromone present exhibited normal growth after 1h from the transfer to the new medium. Cells with a WT pheromone present were arrested in their grow as expected. The same reaction was observed for the cells in the medium with pheromones produced by the a cells with our pCUP1_SC_Alpha plasmid, even in a smaller scale. This could be explained by a smaller production of the pheromone from the partially induced pCUP1 promoter.

Then, we tested reaction of the alpha cells transformed with pRSII416_pGAL1_STE2 plasmid in both media:

Alpha cells with our STE2 receptor response

Cells in media without any pheromone exhibited normal growth after 1h from the transfer to the new medium. Cells in the media with WT pheromone exhibited growth arrest as expected and the cellls in media with pheromones produced by a cells with our pCUP1_SC_Alpha plasmid exhibited only partial arrest, which corresponds to the lower production of the pheromone (as mentioned above).

Also, a cells transformed with the pCUP1_SC_Alpha were examined under the microscope:

A cells producing our pheromone

Summary: Coupling of the introduced STE2 receptor to the pheromone mating pathway and successful production and secretion of the introduced mating pheromone to a cells were demonstrated.

Results

Test of orthogonality (growth arrest approach)

To test the orthogonality of the two most promising receptors (SC and CP-SC), we conducted an assay using the growth arrest as the indicator of the STE2 receptor activation.

Both receptors in a cells (7284) and the corresponding pheromones in a cells (Δbar1) were incubated for 60h in SD-min media, supplemented with proper amino acids.

After incubation, cultures with pheromones were centrifuged (3000g) and transferred into SG-min media supplemented with AAs and 100μM CuSO4 in order to induce the pheromone production. After 4h, their OD was measured and cultures were centrifuged (4000g). The supernatants with produced pheromones were diluted to the same concentration (according to the OD measured) and kept at RT during the plate preparation.

At the same time, cultures with receptors were centrifuged (3000g) and transferred into SG-min media (300μL). Each well then contained 20μL of the receptor culture + 80μL of the media with single pheromone.

Measurements were done every 10min, shaking was set to medium and the temperature was 30°C.

The measured responses to both pheromones are shown here:

Czech Republic ig2 OD SC final.png
Czech Republic ig2 OD CP final.png

As can be seen, both receptors were activated only by their corresponding pheromones. This demonstrated the orthogonality of these two receptors.

Summary: We have experimentally verified the orthogonality of the two of our receptors.

Test of orthogonality (fluorescence approach)

Czech Republic ig2 flTest.png

Final constructs

Our module has developed many plasmids throughout the summer. The main contribution is the creation of a library of different STE2 receptors and the corresponding pheromones that can be functionally expressed in Saccharomyces cerevisiae. All plasmids were verified using restriction digest, gel electrophoresis and DNA sequencing.

To recapitulate, we present here a complete list of plasmids.

Receptors

  • Saccharomyces cerevisiae with its natural C-terminal
  • Candida albicans with its natural C-terminal
  • Candida parapsilosis with C-terminal from Candida albicans
  • Candida parapsilosis with C-terminal from Saccharomyces cerevisiae
  • Candida tropicalis with C-terminal from Candida albicans
  • Lodderomyces elongisporus with C-terminal from Saccharomyces cerevisiae

All the receptors above were put under the control of the inducible pGAL1 and constitutive pADH1 promoter. Receptors under the control of pADH1 were also put on the pRSII415 vector (to change the selectable marker from ura to leu).

In total, 18 plasmids were constructed.

Pheromones

Plasmids with a secretion tag and pheromones from these species were constructed:

  • Saccharomyces cerevisiae
  • Candida albicans
  • Candida parapsilosis
  • Candida parapsilosis
  • Candida tropicalis
  • Lodderomyces elongisporus

All pheromones were put under the control of the inducible pCUP1 promoter and pGAL1 promoter. Pheromones with pCUP1 promoter were also put on the pRSII415 vector (to change the selectable marker from ura to leu).

In total, 15 plasmids were constructed.

References

  1. Lin, C.-H., Choi, a., & Bennett, R. J. (2011). Defining pheromone-receptor signaling in Candida albicans and related asexual Candida species. Molecular Biology of the Cell, 22(24), 4918–4930. doi:10.1091/mbc.E11-09-0749
  2. Caplan, S., Green, R., Rocco, J., & Kurjan, J. (1991). Glycosylation and structure of the yeast MF alpha 1 alpha-factor precursor is important for efficient transport through the secretory pathway. Journal of Bacteriology, 173, 627–635. doi:10.1039/c1mb05175j
  3. Kurjan J, Herskowitz I. (1982) Structure of a yeast pheromone gene (MF alpha): a putative alpha-factor precursor contains four tandem copies of mature alpha-factor. Cell. 1982 Oct;30(3):933-43. doi:10.1016/0092-8674(82)90298-7
  4. Caplan, S., Green, R., Rocco, J., & Kurjan, J. (1991). Glycosylation and structure of the yeast MF alpha 1 alpha-factor precursor is important for efficient transport through the secretory pathway. Journal of Bacteriology, 173, 627–635. doi:10.1039/c1mb05175j
  5. Janiak, A. M., Sargsyan, H., Russo, J., Naider, F., Hauser, M., & Becker, J. M. (2005). Functional expression of the Candida albicans alpha-factor receptor in Saccharomyces cerevisiae. Fungal Genetics and Biology, 42(2005), 328–338. doi:10.1016/j.fgb.2005.01.006