Team:Czech Republic/Project/Location tags

Location Tags

Abstract

To guarantee the ability of our system to recognize, bind, and respond to the presence of a tumour cell, we selected five antibody fragments to display on our yeast cells using the yeast display technology and monitor the cells' binding. Their expression was detected and monitored on a microfluidic chip and was also visualized with the use of antibody staining and fluorescence microscopy.

Key Achievements

  • Expressed streptavidin, EpCAM, Anti-EpCAM scFv, c-Myc scFv and anti-HuA scFv on the surface of yeasts.
  • Monitored the dynamic binding of our receptors and corresponding markers.
  • Demonstrated the ability of our receptors to bind chosen markers.

Introduction

To enable our modified Saccharomyces cerevisiae cells to bind extracellular markers, we expressed single-chain variable fragments of antibodies (scFvs) on their surface. These proteins are fused with the adhesion subunit of a-agglutinin, which is a protein naturally used by S. cerevisiae for aggregation during mating. Binding of the antibody to its specific marker enables full development of a signal transduction dependent on the pheromone signaling pathway. We proposed a modified yeast display technique to enable our cells to present the antibody fragments on their surface at all times. We were able to detect and measure the binding of several oncogenic, epithelial, and blood markers.

Agglutinins

Alpha-agglutinin and a-agglutinin are cell wall glycoproteins of S. cerevisiae that possess complementary surfaces and mediate cell-to-cell adhesion during mating [Lipke and Kurjan, 1992]. A-agglutinin consists of two subunits, of which Aga1p is anchored to the membrane by a glycosylphosphatidylinositol anchor (GPI) and to which the second subunit, Aga2p, is bound by two disulphide bonds. Alpha-agglutinin is composed of only one subunit and is connected to a modified GPI anchor. They are both highly glycosylated and constitutively expressed in low levels [Zhao et al, 2001].

Yeast Display

The Yeast Surface Display was first described in 1997 by E. Border and K. Wittrup as a method for engineering cell surface and secretion proteins. It provides a great advantage of the possibility of post-translational modifications in a eukaryotic organism - yeast. One of the most widespread uses of Yeas Display is screening polypeptide libraries for high-affinity antibodies[Boder and Wittrup, 1997].

Design

We obtained the original yeast display system from professor Sheldon Park, which we are thankful for. This particular PYD plasmid used the BamHI and NheI sites for insertion of scFv sequences and possessed a hemagglutinin tag upstream of the scFv sequence insertion site and a FLAG epitope at the downstream end.

Also, we made several modification to the yeast display method in order for it to better suit our needs. The goal was to simplify it and reduce the amount of new DNA that needs to be introduced into a yeast cell. The first of two alternatives was based on creating a general cassette containing a promoter, a terminator, and necessary cloning sites. The second alternative meant attaching the specific antibody with a terminal epitope tag directly to Aga1 protein.

Traditional Yeast Display

Modified Yeast Display

Expression Cassette

We wanted to build five variations of the pRSII col plasmid based on which final cassette will act as the insert. The design of our cassette included using the constitutive pTv3 promoter, and a terminator sequence. One of the five final cassettes would contain the sequence coding for the Aga1 protein, and four of the cassette inserts would contain sequences coding for Aga2 proteins fused with a single chain antibody of choice and. By carefully designed consequent PCR reactions and restriction digests we aimed to obtain in vitro the 1) promoter, 2) terminator, 3) promoter and terminator, 4) promoter, ORF and terminator. Subsequent restriction digests and ligations would lead to a complete expression plasmid containing our desired inserts. See the Figure 3.2 for a graphical explanation.

Figure 3.3: Adapted from Wasilenko et al[Wasilenko et al, 2010].

Aga1p only

By fusing the antibody fragment directly to the Aga1 protein, we are able to eliminate the complications that arise because of the translation of several proteins in a row. The courage to pursue this alternative stemmed from the positive results obtained by J. Wasilenko and colleagues in their work of displaying the hemagglutinin of avian influenza virus on yeast cells using alpha-agglutinin. We aimed to incorporate into only one plasmid the sequence for an antibody fused with the C-terminal end of Agalpha1 (alpha-agglutinin) and a secretion signal. All of it to be controlled by one promoter [Wasilenko et al, 2010]. See Figure 3.3 for a schematic of the plasmid enabling yeasts to express an antibody on its surface using only the Aga1 protein.

Choice of Markers

Streptavidin

Streptavidin was our first choice of a marker because of its extremely strong bond with biotin. It could give us not only great results but also a benchmark affinity value to compare the other antibodies’ affinities to.

EpCAM

EpCAM, the transmembrane epithelial cell adhesion molecule, functions in cell signalling, proliferation, differentiation, and is present in many carcinomas. We selected it because of its significance in tumor growth promotion and its ability to bind Anti-EpCAm, which we also expressed on S. cerevisiae using yeast display.

c-myc

c-Myc is a transcription factor that regulates cell growth, apoptosis, and cellular differentiation. Its levels are often upregulated in different cancer types, where it plays a role in gene duplication and Ras interaction.

HuA

HuA stands for human antigen A of red blood cells. The decision to enable the expression of an antibody against antigen A on yeast surface allows us to test our system directly in blood and prove that the positive agglutination reaction is specific and clearly visible.


Construction

Construction of Traditional Yeast Display Plasmids

We used modified pCT302 plasmid (https://www.addgene.org/41845/) and inserts described below for the construction of our final yeast display plasmids. Strain EBY100 was used for yeast display experiments. Expression of the protein display on the yeast surface can be readily induced by addition of galactose to the growing medium.

More information about sequences used in yeast display experiments:

Streptavidin

The gene encoding streptavidin protein is 381 bps long. Sequences containing priming sites for M13 forward and reverse primers were added at the ends of the synthesized streptavidin so that streptavidin gene could be amplified with these commonly used primers. Cutting sites for BamHI and NheI restriction endonucleases were also added for easy cloning into the yeast display plasmid.

ATGGCTGAAGCTGGTATCACCGGCACCTGGTACAACCAGCTGGGTTCCACCTTCATCGTTACCGCTGGTGCTGACGGTGCTCTGACCGGTACCTACGAATCCGCTGTTGGTAACGCTGAAAGCCGCTACGTTCTGACCGGTCGTTACGACTCCGCTCCGGCTACCGACGGTTCCGGAACCGCTCTGGGTTGGACCGTTGCTTGGAAAAACAACTACCGTAACGCTCACTCCGCTACCACCTGGTCTGGCCAGTACGTTGGTGGTGCTGAAGCTCGTATCAACACCCAGTGGTTGTTGACCTCCGGCACCACCGAAGCCAACGCGTGGAAATCCACCCTGGTTGGTCACGACACCTTCACCAAAGTTAAACCGTCCGCTGCTTCTTAA

Sequence was extracted from the iGEM parts database and further optimized for expression in yeasts (http://parts.igem.org/Part:BBa_K283010).

EpCAM

EpCAM protein consists of 314 amino acids. We used the sequence encoding only the extracellular part of the EpCAM protein (729 bps long). We also added restriction sites for BamHI, NheI (yeast display) and SpeI, EcoRI (EpCAM production) endonucleases with PCRs.

ATGCAAGAAGAATGTGTATGTGAAAATTATAAACTAGCTGTCAACTGTTTTGTAAATAACAATAGACAGTGTCAATGTACTTCCGTTGGCGCTCAAAACACAGTTATCTGTTCTAAACTAGCCGCGAAGTGTCTTGTTATGAAGGCAGAGATGAATGGCTCCAAACTGGGTAGGCGTGCCAAGCCTGAGGGTGCCCTACAGAACAATGATGGGCTTTACGATCCAGATTGTGATGAATCCGGTTTATTCAAAGCCAAGCAGTGTAATGGTACTTCCATGTGCTGGTGTGTAAACACCGCTGGAGTGAGGAGAACCGATAAAGACACGGAAATCACCTGTAGCGAAAGAGTCAGGACTTACTGGATCATTATCGAACTGAAGCACAAAGCTAGGGAGAAGCCTTATGACAGCAAAAGTTTGAGGACTGCCTTACAGAAAGAAATCACAACTAGGTATCAATTAGACCCGAAATTTATAACGAGTATCCTTTACGAGAATAACGTCATTACCATTGATCTAGTGCAAAATTCTTCCCAGAAGACTCAAAATGACGTTGATATTGCAGATGTTGCCTATTACTTTGAAAAAGATGTGAAAGGAGAGAGTTTGTTCCACTCAAAAAAGATGGATCTGACAGTTAACGGGGAACAGTTAGATCTTGATCCGGGTCAAACGTTAATATATTATGTTGACGAAAAAGCACCAGAATTTAGTATGCAGGGATTGAAATAA

The sequence was extracted from the Uniprot database and further optimized for expression in yeasts (http://www.uniprot.org/uniprot/P16422).

Anti-EpCAM

This sequence encodes part of the C215 Anti-EpCAM antibody (scFv) and is 756 bps long. It consists of sequences encoding light and heavy chains of the antibody. These sequences are connected through a G4S linker. Restriction sites recognized by BamHI and NheI were added for easy cloning into the yeast display plasmid.

ATGCAGGTCAAGCTtCAGCAGTCAGGGGCTGAACTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAACTACTGGATAAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAAATATTTATCCTTCTTATATTTATACTAACTACAATCAAGAGTTCAAGGACAAGGTCACATTGACTGTAGACGAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGTACAAGATCCCCTTATGGTTACGACGAGTATGGTCTGGACTACTGGGGCCAAGGCACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATCGAGCTCACTCAGTCTCCATCCTCCCTGACTGTGACAGCAGGAGAGAAGGTCACTATGAACTGCAAGTCCAGTCAGAGTCTGTTAAACAGTAGAAATCAAAAGAACTACTTGACCTGGTACCAGCAGAAACCAGGGCAGCCTCCTAAACTGTTGATATACTGGGCATCCACTAGGGAATCTGGGGTCCCTGATCGCTTCACAGGCAGTGGATCTGGAACAGATTTCACTCTCACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTATTACTGTCAGAATGATTATGTTTATCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAAATAAAACGGTAA

The sequence was extracted from the European Nucleotide Archive database and further optimized for expression in yeasts (http://www.ebi.ac.uk/ena/data/view/AJ564232).

Anti-c-Myc (9E10)

This sequence encodes part of the 9E10 Anti-cMyc antibody (scFv) and is 780 bps long. It consists of sequences encoding light and heavy chains of the antibody. These sequences are connected by a Yol linker containing a Yol epitope. Restriction sites recognized by BamHI and NheI were added for easy cloning into the yeast display plasmid.

ATGCAGGTGCAGCTaCAGGAGTCTGGGGGAGACTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTCACTATGGCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAACCATTGGTAGTCGTGGTACTTACACCCACTATCCAGACAGTGTGAAGGGACGATTCACCATCTCCAGAGACAATGACAAGAACGCCCTGTACCTGCAAATGAACAGTCTGAAGTCTGAAGACACAGCCATGTATTACTGTGCAAGAAGAAGTGAATTTTATTACTACGGTAATACCTACTATTACTCTGCTATGGACTACTGGGGTCAAGGAGCCTCAGTCACCGTCTCCTCAGCCAAAACAACACCCAAGCTTGAAGAAGGTGAATTTTCAGAAGCACGCGTAGATATCGTTCTCACTCAATCTCCAGCTTTCTTGGCTGTATCTCTAGGACAGAGGGCCACCATCTCCTGtAGAGCCAGCGAAAGTGTTGATAATTATGGCTTTAGTTTTATGAACTGGTTCCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCTATGCTATATCCAACCGAggttctGGGGTCCCTGCCAGGTTTAGTGGCAGTGGGTCTGGGACAGACTTCAGCCTCAACATCCATCCTGTAGAGGAGGATGATCCTGCAATGTATTTCTGTCAGCAAACTAAGGAGGTTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGGGCTGTTGCTTAA

The sequence was extracted from the article "Primary structure and functional scFv antibody expression of an antibody against the human protooncogene c-myc." and further optimized for expression in yeasts (http://www.ncbi.nlm.nih.gov/pubmed/9219032).

Anti-HuA

This sequence encodes part of the AC-1001 Anti-HuA (Human antigen A) antibody (scFv) and is 735 bps long. It consists of sequences encoding light and heavy chains of the antibody. These sequences are connected by a G4S linker. Restriction sites recognized by BamHI and NheI were added for easy cloning into the yeast display plasmid.

ATGCAAGTCCATTTAGTGGAGTCAGGTGGTGGCGTAGTTCAACCTGGAAGATCATTGACACTTTCCTGTGCTGCGTCCGGTTTTACCTTCAATTCTTATACGTTCCACTGGGTAAGACAAACCCCAGGTAAAGGTCTTGAATGGGTTGCAGTTTTAGCATACGACGGGAGTTACCAGCATTATGCAGATTCCGTGAAAGGAAGATTTACAATTTCCAGAGATAACAGCAAAAATACTTTATACTTGCAAATGAATAGTCTGAGACTTGAAGACACAGCGGTATACTTCTGTGCAAGGGGACAGACTACAGTTACTAAAATTGATGAGGACTATTGGGGGCAGGGTACATTGGTAATTGTCTCCTCCGGTGGTGGCGGTAGTGGAGGCGGTGGCTCCGGGGGAGGGGGCTCTGAGATCGTCCTTACCCAGTCTCCAGCAACGCTTAGTTTGTCTCCTGGAGAAAGAGCTACACTTTCTTGCAGAGCAAGCCAGTCTGTCTCTTCTTACTTAGCTTGGTATCAGCAAAAACCAGGTCAGGCTCCAAGGTTGCTGATATATGATGCATCTAACAGGGCGACTGGTATTCCTGCCAGGTTTTCCGGCTCCGGTTCTGGCACTGACTTCACACTTACTATTTCATCTCTAGAACCAGAAGATTTTGCCGTTTATTACTGCCAGCAGAGATCTAATTGGCCTAGGTCTTTTGGTCAGGGTACGAAGGTCGAGATCAAAAGGTAA

The sequence was extracted from the article "Human and mouse monoclonal antibodies to blood group A substance, which are nearly identical immunochemically, use radically different primary sequences." and further optimized for expression in yeasts (http://www.ncbi.nlm.nih.gov/pubmed/7759488).

Construction of Expression Cassette

Sequence of the Aga1 protein was amplified from yeast genome using Q5 polymerase and sequences of the pTv3 promoter and CYC terminator was amplified from plasmids provided by Module 1 (working on synthetic haploids). The primers we used are disclosed in the table below.

Name Sequence
pTv3 down TTAACAGAATTCGGATTCTCACAATCCTGTCGGT
pTv3 up ATAATTCTCGAGAAGCTTGGACTTCCCACCGCCTTC
CYC TT down ACAAAAGTCGACTCTAGACGAGCGTCCCAAAACCT
CYC TT up ATATTAGAATTCATTATTAAATGGATCCTCATGTAATTAGTTATGTCACGCT
Aga1 down ATATATGGATCCTTAACTGAAAATTACATTGCAAGCA
Aga1 up ATATTAGAATTCACCACCATGACATTATCTTTCGCTCATTTTAC

The amplification of Aga1 and assembly of the promoter and the terminator in one sequence was successful as proved by gel electrophoresis and subsequent gel purification. However, even after many repeated tries to clone the premature cassette into the pRS413 and pRS415 plasmids, our efforts remained futile. We tried using different ligases, amount of electroporated cells, and even a different cloning vector. As a result, we turned our focus solely on testing and improving the first of the three approaches - the original yeast display system.

Construction of Yeast Display Using only One Plasmid

This alternative greatly appealed to us thanks to its elegance and simplicity, but proved to be quite time-consuming to prepare. Therefore we only finished the design of the system that can be seen in Figure 3.4 below and assigned the idea only for future experiments.

Figure 3.4: Design of the vector for expressing antibodies on yeast surface using only one plasmid.

Materials and Methods

Strains

E. coli

  1. DH5α

S. cerevisiae

  1. EBY100
  2. BY4741
  3. 7284 MATa

Materials

  1. LB-M agar plates with ampicillin
  2. 1.5 ml eppendorf tubes
  3. 0.5 ml PCR tubes
  4. 50 ml centrifuge tubes
  5. NucleoSpin Plasmid DNA, RNA, and protein purification Kit
  6. NucleoSpin Gel and PCR Clean-up Kit
  7. LB-M medium with chloramphenicol
  8. YPD medium
  9. SD-min medium + CAA
  10. NaOH agarose gel and buffer
  11. TAE agarose gel and buffer

Methods

  1. Transformation
  2. Minipreparation of plasmid DNA
  3. Restriction digest
  4. Ligation
  5. NucleoSpin gel clean-up
  6. NucleoSpin plasmid DNA purification
  7. Induction of protein display
  8. Fluorescent immunostaining

Detailed description of all methods can be found on our Protocols page.

Results

Microscopy

Immunofluorescent labeling of displayed proteins

Interactions of EpCAM and Anti-Ep CAM scFv

Microfluidics

Yeast-induced blood agglutination on chip

The master experiment

References

  1. Zhao, H.,Shen, Z.-M., Kahn, P. C. and Lipke, P. N. (2001). Interaction of α-Agglutinin and a-Agglutinin, Saccharomyces cerevisiae Sexual Cell Adhesion Molecules. Journal of Bacteriology, 183(9), 2874–2880. doi:10.1128/JB.183.9.2874-2880.2001
  2. Lipke, P. N. and Kurjan, J. (1992). Sexual agglutination in budding yeasts: structure, function, and regulation of adhesion glycoproteins. Microbiology and Molecular Biology Reviews, 56(1), 180-194.
  3. Boder, E. T. and Wittrup, K. D. (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nature Biotechnology, 15, 553-557. doi:10.1038/nbt0697-553
  4. Baird, C. et al. (2012). Yeast Display scFv Antibody Library User’s Manual. Richland, WA: Pacific Northwest National Laboratory.
  5. Wasilenko, J. L. et al. (2010). Cell Surface Display of Highly Pathogenic Avian Influenza Virus Hemagglutinin on the Surface of Pichia Pastoris Cells Using alpha-Agglutinin for Production of Oral Vaccines. Biotechnology Progress, 26(2), 542-547. doi:10.1002/btpr.343.