Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 20: Line 20:
  
 
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO85 </span>
 
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO85 </span>
−
<br><span style="color:#179A89"> -&nbsp;Primer Kan
+
<br><span style="color:#179A89"> -&nbsp;Primer Kan </span>
  
 +
<br><h3>Gene PHO80</h3>
  
 
<br>5’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br>
 
<br>5’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br>
−
<br>5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
+
<br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT
−
<br>tail homologie PHO80
+
  
−
<br>ACATTTTGATGGC-3’
+
<br>ACATTTTGATGGC</span>-3’
−
<br>Primer Kan
+
 
<br>
 
<br>
 +
  
 
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br>
 
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br>
−
<br>3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
+
<br>3’-<span style="color:#9A1717">CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCA</span><span style="color:#179A89">CAGCAGTATAGCGACCA
−
<br>tail homologie PHO80
+
 
 +
<br>GCATTC</span>-5’
 +
 
  
−
<br>GCATTC-5’
 
−
<br>Primer Kan
 
 
<br>
 
<br>
 +
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO80 </span>
 +
<br><span style="color:#179A89"> -&nbsp;Primer Kan </span>
 +
 +
<br><h3>Gene FRT + PHO85</h3>
  
 
<br>5’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br>
 
<br>5’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br>
−
<br>5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
+
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC
−
<br>tail homologie PHO85
+
  
−
<br>TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
+
<br>TCTAGAAAGTATAGGAACTTC</span><span style="color:#179A89">ATAATCATTTGCATCCATACATTTTGATGGC</span>-3’
−
<br>FRT Primer Kan
+
  
  
 
<br>
 
<br>
 
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br>
 
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br>
−
<br>3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
+
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">CTTCAAGGATAT
−
<br>tail homologie PHO85
+
 
 +
 
 +
<br>GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’
  
−
<br>GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
 
−
<br>FRT Primer Kan
 
  
  

Revision as of 15:15, 14 August 2015

Background

Aims

Results

Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.

5/08/15


Design primers


Gene PHO85

5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’

3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’

- tail homologie PHO85
- Primer Kan

Gene PHO80


5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.

5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC-3’

3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.

3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC-5’

- tail homologie PHO80
- Primer Kan

Gene FRT + PHO85


5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’