Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 7: Line 7:
 
<h3>Gene PHO85</h3>
 
<h3>Gene PHO85</h3>
  
5’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
+
5’Primer  of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
 
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#179A89">ATAATCATTTGCA
 
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#179A89">ATAATCATTTGCA
  
Line 13: Line 13:
 
<br>
 
<br>
  
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
+
<br>3’Primer  of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
 
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#179A89">CAGCAGTATAG
 
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#179A89">CAGCAGTATAG
  
Line 19: Line 19:
 
<br>
 
<br>
  
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO85 </span>
+
<br><span style="color:#9A1717"> -&nbsp;tail homology PHO85 </span>
<br><span style="color:#179A89"> -&nbsp;Primer Kan </span><br>
+
<br><span style="color:#179A89"> -&nbsp;Primer Kanamycin </span><br>
  
 
<br><h3>Gene PHO80</h3>
 
<br><h3>Gene PHO80</h3>
  
5’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
+
5’Primer  of <i>Kanamycin<i> resistance gene with tails using to transformation with the PHO80 gene of the yeast.
 
<br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT
 
<br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT
  
Line 31: Line 31:
  
  
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
+
<br>3’Primer  of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
 
<br>3’-<span style="color:#9A1717">CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCA</span><span style="color:#179A89">CAGCAGTATAGCGACCA
 
<br>3’-<span style="color:#9A1717">CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCA</span><span style="color:#179A89">CAGCAGTATAGCGACCA
  
Line 38: Line 38:
  
 
<br>
 
<br>
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO80 </span>
+
<br><span style="color:#9A1717"> -&nbsp;tail homology PHO80 </span>
<br><span style="color:#179A89"> -&nbsp;Primer Kan </span><br>
+
<br><span style="color:#179A89"> -&nbsp;Primer Kanamycin </span><br>
  
 
<br><h3>Gene FRT + PHO85</h3>
 
<br><h3>Gene FRT + PHO85</h3>
  
5’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
+
5’Primer  of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
 
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC
 
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC
  
Line 50: Line 50:
  
 
<br>
 
<br>
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
+
<br>3’Primer  of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
 
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">CTTCAAGGATAT
 
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">CTTCAAGGATAT
  
Line 56: Line 56:
 
<br>GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’
 
<br>GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’
 
<br>
 
<br>
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO85 </span>
+
<br><span style="color:#9A1717"> -&nbsp;tail homology PHO85 </span>
 
<br><span style="color:#36C40F"> -&nbsp;FRT</span>
 
<br><span style="color:#36C40F"> -&nbsp;FRT</span>
<br><span style="color:#179A89"> -&nbsp;Primer Kan </span><br>
+
<br><span style="color:#179A89"> -&nbsp;Primer Kanamycin </span><br>
  
  
 
<br><h1>12/08/15</h1>
 
<br><h1>12/08/15</h1>
 
<h2>Culture</h2>
 
<h2>Culture</h2>
The saccharomyces cerevisiae SK1 was thaw and sow 100µL of it on YPD medium overnight. (at 30°C)
+
The Saccharomyces cerevisiae SK1 was thaw and sow 100µL of it on YPD medium overnight. (at 30°C)
 
<br>This yeast will be transformed.<br>
 
<br>This yeast will be transformed.<br>
 
<br><h2>PCR</h2>
 
<br><h2>PCR</h2>

Revision as of 20:27, 14 August 2015

Background

Aims

Results

Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.

5/08/15

Design primers


Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC
-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC
-5’

- tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC
-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC
-5’

- tail homology PHO80
- Primer Kanamycin

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTC
ATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAG
CAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin

12/08/15

Culture

The Saccharomyces cerevisiae SK1 was thaw and sow 100µL of it on YPD medium overnight. (at 30°C)
This yeast will be transformed.

PCR

3 PCR were realized on OH plasmid to create a Kanamicine resistance marker, thanks to 3 pair of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

13/08/15

PCR purification

Protocol: Dilute PCR product (5 or 10 times ?) with the resuspension buffer. Pour it in a purification column. Centrifuge 30sec at 14K rpm Throw the filtrat Add 700µL of EtOH (washing solution) Centrifuge 30sec at 14K rpm DThrow the filtrat Add 500µLof washing solution Centrifuge 30sec at 14K rpm Throw the filtrat Centrifuge 30sec at 14K rpm Throw the filtrat Put the column in a Eppendorf Add 45µL of RNAse/DNAse free water right on the membrane Wait 2min Centrifuge 2min at 10K rpm

PCR The PCR control with an electrophoresis




We expected strips around 1.300bp. The strip corresponding to marker with FRT is bigger than the two others strips wich have just the Kan resistance with tails.

pre-culture

Swo one colony saccharomyces (...) of the yesterday in 5mL of the liquid YPD medium, let 's grow overnight.

14/08/15