Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Line 206: | Line 206: | ||
There is a culture in plates.<br> | There is a culture in plates.<br> | ||
− | The negative control is not good. | + | The negative control is not good. The no change yeast grow in the YPD medium with the antibiotic. We will repeat this control on an agar plate and not in a liquid medium.<br> |
− | We analyze anyway down results, the results of the new control will allow us to validate the result of our | + | We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br> |
− | We see more | + | We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br> |
− | We look few | + | We look only few colonies in the plates with yeast transforming PHO80.<br> |
<br> | <br> | ||
− | Verification of the | + | Verification of the results thanks to the colony PCR, to determinate if the resistance is integrated.<br> |
− | + | Create the primer:<br> | |
− | + | Primer 5'-3' PHO80<br> | |
+ | <span style="color:#179A89">ATCATAAGACGAGGATATCCTTTGGAG</span><br> | ||
+ | Primer 3'-5' PHO80<br> | ||
+ | <span style="color:#179A89">CTCAATCATGATTGCTTTCATAATACCCC</span><br> | ||
+ | Primer 5'-3' PHO85<br> | ||
+ | <span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br> | ||
+ | Primer 3'-5' PHO85<br> | ||
+ | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br> | ||
+ | Primer 5'-3' FRT+PHO85<br> | ||
+ | <span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br> | ||
+ | Primer 3'-5' FRT+PHO85<br> | ||
+ | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br> | ||
Revision as of 12:14, 17 August 2015