Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"
Line 8: | Line 8: | ||
− | < | + | <br><br><h1 class="date">13/07</h1><br><br> |
<ul> | <ul> | ||
Line 166: | Line 166: | ||
− | < | + | <br><br><h1 class="date">14/07</h1><br><br> |
Launched the two different PCR with different Tm.<br/><br/> | Launched the two different PCR with different Tm.<br/><br/> | ||
Line 336: | Line 336: | ||
</table> | </table> | ||
− | <br | + | |
+ | |||
+ | |||
+ | |||
+ | <br><br><h1 class="date">16/07</h1><br><br> | ||
+ | |||
Annealing of o15.011 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAT) and o15.012 (CTAGATCCCCCAAGTCTTCGAAGACAAGCATGG) using the following protocol: | Annealing of o15.011 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAT) and o15.012 (CTAGATCCCCCAAGTCTTCGAAGACAAGCATGG) using the following protocol: | ||
<br/> | <br/> | ||
Line 411: | Line 416: | ||
− | <br | + | <br><br><h1 class="date">20/07</h1><br><br> |
+ | |||
-Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously. | -Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously. | ||
Line 442: | Line 448: | ||
− | <br | + | <br><br><h1 class="date">21/07</h1><br><br> |
+ | |||
Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol. | Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol. | ||
Line 538: | Line 545: | ||
− | <br><br>< | + | <br><br><h1 class="date">22/07</h1><br><br> |
<b>Transformation results</b> | <b>Transformation results</b> | ||
Line 581: | Line 588: | ||
− | <br><br>< | + | <br><br><h1 class="date">23/07</h1><br><br> |
+ | |||
Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL. | Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL. | ||
Line 618: | Line 626: | ||
− | <br><br>< | + | <br><br><h1 class="date">24/07</h1><br><br> |
Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).<br> | Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).<br> | ||
Line 670: | Line 678: | ||
− | <br><br>< | + | <br><br><h1 class="date">25/07</h1><br><br> |
+ | |||
<b>Transformation results</b> | <b>Transformation results</b> | ||
Line 725: | Line 734: | ||
− | <br><br>< | + | <br><br><h1 class="date">27/07</h1><br><br> |
+ | |||
<b>Transformation results</b> | <b>Transformation results</b> | ||
Line 805: | Line 815: | ||
− | <br><br>< | + | |
+ | |||
+ | <br><br><h1 class="date">28/07</h1><br><br> | ||
Measurement of DNA concentration after digestion/gel extraction: | Measurement of DNA concentration after digestion/gel extraction: | ||
Line 840: | Line 852: | ||
− | <br><br>< | + | <br><br><h1 class="date">30/07</h1><br><br> |
+ | |||
<b>Transformation results</b> | <b>Transformation results</b> | ||
Line 938: | Line 951: | ||
− | <br><br>< | + | <br><br><h1 class="date">30/07</h1><br><br> |
<b>Transformation results</b> | <b>Transformation results</b> | ||
Line 991: | Line 1,004: | ||
− | <br><br>< | + | <br><br><h1 class="date">05/08</h1><br><br> |
+ | |||
Plating Results: | Plating Results: | ||
Line 1,015: | Line 1,029: | ||
− | <br><br>< | + | |
+ | <br><br><h1 class="date">02/08</h1><br><br> | ||
Line 1,025: | Line 1,040: | ||
− | <br><br>< | + | <br><br><h1 class="date">03/08</h1><br><br> |
Restriction Digestion of p15.01 with Eco31I and BbsI (using the digestion protoccol) and PCR purification to remove the enzymes.<br> | Restriction Digestion of p15.01 with Eco31I and BbsI (using the digestion protoccol) and PCR purification to remove the enzymes.<br> | ||
Line 1,032: | Line 1,047: | ||
− | <br><br>< | + | |
+ | |||
+ | <br><br><h1 class="date">04/08</h1><br><br> | ||
Miniprep of all the overnight cultures from clones of p15.06 and p15.07.<br> | Miniprep of all the overnight cultures from clones of p15.06 and p15.07.<br> |
Revision as of 20:08, 14 August 2015