Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"
Line 1,248: | Line 1,248: | ||
p15.06 DreamTaq #B (2 colonies) - p15.01 - 1kb ladder - negatice control PCR (no matrix DNA) <br></li> | p15.06 DreamTaq #B (2 colonies) - p15.01 - 1kb ladder - negatice control PCR (no matrix DNA) <br></li> | ||
<br> | <br> | ||
− | <li> d- zoomed view of two bands of figure 4b | + | <li> d- zoomed view of two bands of figure 4b </li> |
<br> | <br> | ||
<br> | <br> | ||
− | + | </ul> | |
Even when the gel quality is not really good, we observed a strange 8kb band in most of the wells and also in the negative insertion control. These results mean that the either the PCR failed or that the inserted plasmid is not the good one. <br> | Even when the gel quality is not really good, we observed a strange 8kb band in most of the wells and also in the negative insertion control. These results mean that the either the PCR failed or that the inserted plasmid is not the good one. <br> | ||
Line 1,264: | Line 1,264: | ||
<br> | <br> | ||
<img width="20%" src="https://static.igem.org/mediawiki/2015/f/f1/PB_notebookB2_pic11.jpg"/> | <img width="20%" src="https://static.igem.org/mediawiki/2015/f/f1/PB_notebookB2_pic11.jpg"/> | ||
+ | <br> | ||
+ | According to these results, we concluded that two among the three DreamTaqs did not work. It could explain why our precedent colony PCR failed miserably.<br><br> | ||
− | + | We launched overnight cultures of: | |
+ | <ul> | ||
+ | <li>4 colonies of p15.07, BbsI #A, 3:1 ratio</li> | ||
Revision as of 14:27, 19 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
Notebook
Vitamin A Vitamin B2 Vitamin B12 Phytase Riboswitch Differentiation on E. coli Differentiation on S. cerevisiae Manufacturing Idli and Micro-organisms 13/07
- Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT. Dilution in water and PCR amplification, using the following protocol:
- 1 μL gBlock (0.1 to 1ng)
- 1 μL forward primer (10 μM)
- 1 μL reverse primer (10 μM)
- 22 μL DNAse/RNAse free water
- 25 μL LifeTech MasterMix (2X)
- Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down
- Transfer in a centrifugation column
- Centrifuge 1 min at 14000 rpm
- Throw the filtration product
- Add 700μL of washing solution
- Centrifuge 1 min at 14000 rpm
- Throw the filtration product
- Add 500μL of washing solution
- Centrifuge 1 min at 14000 rpm
- Throw the filtration product
- Centrifuge 1 min at 14000 rpm
- Throw the filtration product
- Put the column in a sterile 1.5mL microcentrifuge tube
- Add 45μL of DNAse/RNAse free water on the membrane
- Wait 2 minutes
- Centrifuge 2min at 10000rpm
- Discard the column, DNA is saved in water
12 cycles amplification, using the following parameters:time (min) temperature (°C) function 3:00 98 melting 0:30 98 melting 0:30 52 annealing 1:00 72 extension 10:00 72 extension forever 12 storage -
PCR purification protocol
[PCR product with gBlock] (ng/μL) [PCR product without gBlock] (ng/μL) RibA 3.5 3.4 RibD 6.4 3.3 RibE 5.0 3.7 RibT25 3.5 3.8 RibT48 8.7 3.3
It could be the fallout of the limited number of cycles. (We only used 12 cycles, as advised by IDT)
NEB Tm calculator gave really different Tm for the PCR primers than Geneious and IDT.
We decided to launch two PCR, both with 35 cycles, but with two different annealing
temperature: 52 and 64°C.
14/07
Launched the two different PCR with different Tm.
PCR with high annealing temperature, 35 cycles:
time (min) temperature (°C) function 3:00 98 melting 0:30 98 melting 0:30 64 annealing 1:00 72 extension 10:00 72 extension forever 12 storage
PCR with low annealing temperature, 35 cycles:
time (min) temperature (°C) function 3:00 98 melting 0:30 98 melting 0:30 64 annealing 1:00 72 extension 10:00 72 extension forever 12 storage
After PCR, we ran the PCR products on a TAE - 1% agarose gel (100V, 20min) to check
if the amplification product correspond to the expected size of the gBlocks.
From left to right:
1kb Ladder, RibA, D, E, T25 and T48 amplified at 52°C
and Rib A, D, E, T25 and T48 amplified at 64°C
The bands are not really specific and seems to be smeared over the gel.
However, we can see that the extremity of each band correspond approximatively
to the expected size of our parts, except RibD amplified at 64°C for which no band has been detected. We purified our PCR product according to the previously used protocol,
and then measure the DNA concentration using a Nanodrop.Part Name PCR product amplified at 52°C concentration (ng/μL) PCR product amplified at 64°C concentration (ng/μL) RibA 54.3 132.7 RibD 50.5 140.2 RibE 67.1 78.2 RibT25 63.6 136.0 RibT48 61.2 143.1 16/07
Annealing of o15.011 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAT) and o15.012 (CTAGATCCCCCAAGTCTTCGAAGACAAGCATGG) using the following protocol:
Annealing Protocol - Phosphorylation of the oligos
- 5.6μL DNAse/RNAse free water
- 6.0μL o15.011 (10µM)
- 6.0μL o15.012 (10µM)
- 2.0μL 10X T4 DNA ligase buffer
- 0.4μL T4 PolyNucleotide Kinase Total: 20μL
- incube 30min at 37°C
- add 1μL of 1M NaCl
- incube 5min at 95°C
- let the mix cool down
- use 2μL of the mix as a 10X solution
Inoculate LB + erythromycin (150ng/μL) with g15.21 containing pKV6.
Inoculate M17 + erythromycin (10ng/μL) with g15.13 containing pSIP411.
17/07
Miniprep of g15.13 and g15.21 as describe below:Miniprep protocol using a QIAGEN kit - centrifuge an overnight culture of cells 10min at 4krpm
- throw the filtrate
- resuspend the pellet in 250μL of Cell Resuspension Solution then mix it
- transfer it in a 1.5mL microcentrifuge tube
- add 250mL of Cell lysis solution and mix by inverting several times
- incube until the liquid is clear, maximum 5min
- add 10μL of Alkalyne protease solution, mix by inverting several times and incube 3 to 4 min
- add 350μL of Neutralisation Solution and mix by inverting several times
- centrifuge 10min at 14krpm
- add the supernatant in a column
- centrifuge 1min, 14krpm, then throw the filtrat
- add 750μL Washing Solution
- centrifuge 1min, 14krpm, then throw the filtrat
- add 250μL Washing Solution
- centrifuge 2min, 14krpm, then throw the filtrat
- centrifuge 1min, 14krpm
- transfer the column in a sterile microcentrifuge 1.5ml tube
- add 50μL of DNAse/RNAse free water right on the membrane of the filter, wait 1min
- centrifuge 1min, 14krpm
- throw the column, plasmid is saved in water
As g15.13 is a gram positive bacteria, we added 1mL of 10mg/mL Lysozyme at the same time that the cell lysis solution.
Measurement of DNA concentration20/07
-Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously. -PCR of pSIP411 ORI and resistance cassette (erythromycin) using o15.070 and o15.071. We will call it pSIPnew to write clearer explanations. The size of this fragment is 3.1kb, so the elongation phase was extended to 2min. a negative PCR control was made at the same time (without matrix DNA). PCR purification after the PCR and concentration measurement:Concentration (ng/μL) pSIPnew 99.0 negative control 0.0 21/07
Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol.Digestion Protocol
- Prepare the following mix:
- 4μL of Enzyme 1
- 4μL of Enzyme 2
- 4μL of FastAP
- 12μL of Fast Digest buffer 10X
- 1 to 3 μg of DNA
- up to 120μL of water
- mix by pipetting up and down
- incube 10min at 37°C
For pSIPnew: SalI and XbaI, 30μL of DNA (99ng/μL), 66μL of water.
For pKV6: SalI and EcoRI, 10μL of DNA(270ng/μL), 86μL of water.
PCR purification of both digested pKV6 and pSIPnew
Measure the DNA concentration after PCR purification:
Concentration (ng/μL) pSIPnew 60.8 pKV6 26.4
Ligation of annealed oligos o15.011 and o15.012 with digested pSIP411new and o15.072 and o15.073 with digested pKV6 using the following protocolLigation Protocol
- Mix the following
- vector 100ng
- insert 300ng
- T4 DNA ligase buffer 10X
- T4 DNA ligase
- up to 20µL of water
- incubate 30 to 40 minutes at room temperature
For pSIPnew: 2µL of digested pKV6(60.8ng/µL), 6µL of annealed o15.011/o15.012, 9µL of water.
pKV6 ligated with o15.072/o15.073 and pSIPnew ligated with o15.011/o15.012 will be respectively called p15.01 and p15.02.
Transformation of p15.01, p15.02, pKV6(miniprep), pSIP411(miniprep) and a negative control (no DNA) in NEB DH5α chemically competent cells
Heat Shock transformation protocol
- Thaw frozen chemically competent cells (20µL aliquots) on ice for 10min.
- add 2µL of ligation product (or 0.5µL of miniprep) and incubate the cells 30sec at 42°C.
- put the cells back on ice for 2min.
- add 200µL of LB to the cells and incubate 2 hours at 37°C.
- plate the cells on LB + erythromycin (150µg/mL) or LB + erythromycin (10µg/mL), incubation at 37°C overnight.
22/07
Transformation resultsTransformed product pKV6 pSIP411 p15.01 p15.02 negative control Growth Results - (ery 150µg/mL):
500 colonies, no background
- (ery 10µg/mL):
no growth - (ery 150µg/mL):
lawn of bacteria
- spreading of 170µL:
41 isolated colonies -> isolation of three transformants: T1, T2 and T3 - spreading of 50µL:
3 colonies on a lawny background
- (ery 10µg/mL):
lawn of bacteria - (ery 150µg/mL):
lawny background
no growth 23/07
Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL.Electrocompetent Cells Preparation Protocol - Inoculate two 250mL LB flasks with 100µL of an overnight culture of DH5α
- incubate until the the DO600 reach 0.5 to 0.7
- place the cultures on ice for 15 minutes
- pour the culture in cold sterile 50mL falcon tubes
- centrifuge them for 10 minutes at 6000rpm
- throw the supernatant
- resuspend the cells in 50mL cold distilled water
- centrifuge them for 10 minutes at 6000rpm
- throw the supernatant
- resuspend the cells in 25mL cold distilled water
- centrifuge them for 10 minutes at 6000rpm
- throw the supernatant
- resuspend the cells in 12.5mL cold 10% glycerol
- centrifuge them for 10 minutes at 6000rpm
- throw the supernatant
- resuspend the cells in 5mL cold 10% glycerol
- make aliquots of the desire volume in microcentrifuge tubes and freeze them at -80°C
24/07
Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).
Digestion of pKV6(negative control) and p15.01 with BbsI and Eco31I to control the insertion of the two BbsI sites in p15.01.Analytical digestion protocol
- Prepare the following mix:
- 2µL 10X Digestion buffer
- 0.5µL Eco31I
- 0.5µL BbsI
- 2µL of DNA (200ng)
- 15µL water
- incube 1h at 37°C
Both T2 and T3 transformants present the same bands as pKV6, whereas T1 shows 3 bands at 2.7kb, 1.7kb and 1.4kb.
Oligos used for sequencing are o15.097(CGGTAGAGCTCCCTTCTATGC) and o15.098(CTGGCACGACAGGTTTCCC).
Overnight of T1 in LB+ery(150µG/mL).
Dialyse of both ligation products(p15.01 and p15.02) and both native plasmids (pKV6 and pSIP411) on 0.025µm cellulose filter for 20 minutes.
Transformation of DH5α by electroporation with the previously ligated p15.01 and p15.02.
Electroporation Protocol
- Thaw electrocompetent cells on ice
- Add 2µL of ligation product or 0.5µL of native plasmid to the cells
- Transfer the cells in an 0.2mm electroporation cuvette
- put the cuvette in the electroporation device and pulse the cells at 2.5kV, 200 Ohms and 25µF
- add 200µL of LB right after pulsing
- recover 2 hours at 37°C
- plate 200µL and 50µL of the cells on LB + erythromycin (200µg/mL), incubate overnight at 37°C
25/07
Transformation resultsTransformed product pKV6 pSIP411 p15.01 p15.02 negative control Growth Results lawn of unrecognized bacteria with dense colonies - 200µL:
11 single colonies - 50µL:
7 single colonies
- 200µL:
32 single colonies - 50µL:
0 colony
- 200µL:
thin lawn of unrecognized bacteria with dense colonies - 50µL:
thin lawn of unrecognized bacteria
thin lawn of unrecognized bacteria 27/07
Transformation resultsTransformed product pKV6 pSIP411 p15.01 p15.02 negative control Growth Results 158 single colonies - 200µg/mL:
thin lawn of unrecognized bacteria - 150µg/mL:
thin lawn of unrecognized bacteria
lost during dialysis - 200µg/mL:
thin lawn of unrecognized bacteria - 150µg/mL:
thin lawn of unrecognized bacteria
no growth
For the PCR, o15.070(AAAAACCGCAGGGAGGCAAACAATGA) and o15.071(CGGATTAACGTTAAGAACTCTATTGAAGG) were used to amplify the 3 kb fragment, with an annealing temperature of 69°C (according to NEB Tm calculator) and an elongation time span of 2 minutes.
All the PCR purified product was run on an 1% agarose gel, and gel extraction was performed on the band of approximative size 3kb, according to the following protocol.
Gel Extraction Protocol with QIAGEN kit
- add three times the volume of QG solubilisation buffer with one volume (=mass) of gel extracted
- incubate 10 minutes at 50°C, vortex every 2 or 3 minutes, until the gel is dissolved
- transfer in a provided purification column, centrifuge 1 minute at 14000rpm then discard the filtrat
- add 500µL of solubilisation buffer, centrifuge 1 minute at 14000rpm then discard the filtrat
- add 750µL of washing buffer
- centrifuge 1 minute at 14000rpm then discard the filtrat
- add 500µL of washing buffer
- centrifuge 1 minute at 14000rpm then discard the filtrat
- centrifuge 1 minute at 14000rpm then discard the filtrat
- put the column in a clean 1.5mL microcentrifuge tube
- add 45µL of DNAse/RNAse free water right on the membrane of the column
- wait a couple of minutes and then centrifuge 1 minute at 10000rpm
- discard the column, DNA is saved in water
Concentration measured with Nanodrop was INSERT CONCENTRATION HERE
To get a fresher batch of annealed oligos, we decided to anneal them again, using the same protocol. (o15.011+o15.012 and o15.072+o15.073). The three minipreps from p15.01 transformants were send to sequencing thanks to GATC LightRun NightXpress service.
5µL (~100ng/µL) of all three minipreps were mixed with o15.097 (forward primer, CGGTAGAGCTCCCTTCTATGC) or o15.098 (reverse primer, CTGGCACGACAGGTTTCCC).
28/07
Measurement of DNA concentration after digestion/gel extraction:
Concentration (ng/μL) pKV6 44.8 pSIP411 3kb fragment 79.5
Ligation, dialyse and transformation by electroporation of pSIP411 3kb band + o15.011/o15.012, digested pKV6+o15.072/o15.073 and both native plasmids (pKV6 and pSIP411).
Cells were then plated with bids on LB+erythromycin (200µg/mL) and incubated at 37°C.
Sequencing results: sequencing confirm the insertion of the two BbsI sites in the T1 transformant(=p15.01 plasmid).
Both T2 and T3 did not contain the insert.
T1 was glycerol stocked for long-term conservation, and renamed as g15.49.
30/07
Transformation resultsTransformed product pKV6 pSIP411 p15.01 p15.02 negative control Growth Results thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria
Golden Gate assembly of RibADET25 and RibADET48 in p15.01 and transformation of chemically competent NEB Turbo ''E.coli''. The two new plasmids are respectively named p15.06 and p15.07.
Golden Gate was performed according to the following protocol:Golden Gate protocol
- Mix the following in a PCR tube:
- 1µL T4 DNA ligase buffer
- 1µL BbsI HF
- 2µL NEB GoldenGate Buffer 10X
- 200ng backbone
- 2:1 molarity ratio (insert:vector) of each insert
- up to 20µL with water
- incubate using the following:
Time (minute) Temperature (°C) Function 3 37 FUNCTION 4 16 FUNCTION 5 50 FUNCTION 5 80 FUNCTION storage 12 FUNCTION
Heat shock transformation of both Golden Gate products, p15.01(miniprep), p15.02(ligation product) and pKV6. Recovery two hours at 37°C and plating on LB + erythromycin (150µg/mL). Inoculated LB with NEB Turbo, overnight at 37°C30/07
Transformation resultsTransformed product pKV6 pSIP411 p15.01 p15.02 p15.06 p15.07 negative control Growth Results 204 isolated colonies (0.5 mm) 137 isolated colonies (0.5 to 1 mm) half lawn, half isolated colonies (~500) lawn lawn and some isolated colonies ~1000 tiny isolated colonies no growth
Striked a sample of p15.02 lawn on LB + ery (150µg/mL).
Striked a sample of p15.06 lawn on LB + ery (150µg/mL).
Striked a single colony of p15.07 on LB + ery (150µg/mL).
Incubated overnight at 37°C.
Seeing all the electroporation results so far, we decided to prepare an new batch of electrocompetent NEB Turbo (using the same protocol).
Overnight culture of g15.49 (containing p15.01) in LB + ery (150µg/mL).
05/08
Plating Results:p15.02 p15.06 p15.07 big single colonies big single colonies big single colonies
Miniprep of the g15.49 overnight => p15.01 at 330ng/µL.02/08
All the cultures incubated on the 01/08 grew, except the negative control, and were minipreped.
The three p15.02 transformants were sent for sequencing with o15.099 (forward primer, GCCAGCGGAATGCTTTCATCC) or o15.100 (reverse primer, CATGAATTAGTCTCGGACATTCTGC).03/08
Restriction Digestion of p15.01 with Eco31I and BbsI (using the digestion protoccol) and PCR purification to remove the enzymes.
Picked 10 single colonies from both p15.06 and p15.07 and launched overnight cultures in LB + ery (150µg/mL).
04/08
Miniprep of all the overnight cultures from clones of p15.06 and p15.07.
Restriction digestion with Eco31I of 6 p15.06 and p15.07 minipreped.
p15.06 and p15.07 restriction analysis should produce 6 fragments (first and second may be overlapping) (2.77, 2.7, 1.7, 1.3, 0.9 and 0.6),
whereas p15.01 restriction analysis should only produce two fragments(2.7, 3.4)
Restriction analysis of p15.01, p15.06 and p15.07 with Eco31I on 1% agarose gel.
From left to right: p15.01 non digested, p15.01 digested,
All the digested products are presenting only two bands (and some bands likely to come from Eco31I star activity)us are not containing the four inserts.
We decided to perform an other golden gate/dialyse/transformation with p15.01, p15.06 and p15.07.
According to several advice we received, we tried two different golden gate protocols, the first one using the 2:1 insert:backbone ratio, the second using a 3:1 ratio.
Time constants for each electroporation was about 5.2 or 5.3 msec.
As one tube of BbsI enzyme mysteriously appeared in the fridge, we tested both (A and B).
After one hour of recovery, two volumes (50µL and 170 µL) of each transformed cells were plated on LB + ery (150µg/mL) and incubated overnight at 37°C.
05/08
Transformation resultsTransformed product p15.01 p15.06, BbsI #A, 3:1 ratio p15.06, BbsI #B, 2:1 ratio p15.07, BbsI #A, 3:1 ratio p15.07, BbsI #B, 2:1 ratio Golden Gate negative control (golden gate reaction without inserts) negative growth control more than 500 colonies (1 to 3mm in diameter) - 50µL:
- 170µL:
0 colony
5 colonies- 50µL:
- 170µL:
16 colonies
53 colonies- 50µL:
- 170µL:
4 colonies
65 colonies- 50µL:
- 170µL:
29 colonies
152 colonies- BbsI #A, 170µL:
- BbsI #B, 170µL:
0 colony
0 colony- 50µL:
- 170µL:
0 colony
5 colonies- 50µL:
- 170µL:
0 colony
0 colony
To control the insertion, we used colony PCR with o15.097(CGGTAGAGCTCCCTTCTATGC) and o15.098(CTGGCACGACAGGTTTCCC). The colony PCR were performed on 10 single colonies of p15.06 #B, 10 single colonies of p15.07 # A, 10 single colonies of p15.07 #B and 3 single colonies of p15.06 #A.
If the insertion worked, PCR should amplifiate a 4.8kb band, whereas if the insert is not present, a 0.6kb band should be observed.Colony PCR protocol
- Prepare the following mix
- 1.25µL DreamTaq Green Buffer (10X)
- 1.25µL dNTPs mix (10µM)
- 0.5µL Forward Primer (10µM)
- 0.5µL Reverse Primer (10µM)
- 0.2µL DreamTaq (5U/µL)
- 1µL DNA Template or some cells from a single colonies
- up to 12.5µL water
- Run a PCR with a longer first high temperature phase (5 to 8 more minutes) to lyse the cells, and extend the elongation phase to 1 min/kb
PCR analysis on 1% agarose 0.5X TAE gel.
Figure 3: Confirmation of Insertion of RibADET operon in p15.01 by Electrophoresis
- a- From Left to Right:
p15.07 DreamTaq #A (8 colonies) - 1kb ladder - p15.07 DreamTaq #A (2 colonies) - p15.07 DreamTaq #B (6 colonies) - b- From Left to Right:
p15.06 DreamTaq #B (8 colonies) - 1kb ladder - p15.06 DreamTaq #B (2 colonies) - PCR negative control (no matrix DNA) -
- c- From Left to Right:
p15.07 DreamTaq #B (4 colonies) - 1kb ladder - p15.06 DreamTaq #A (3 colonies) - p15.01 - Colony PCR failed
- The colonies did not contain p15.01, p15.06 or p15.07, however the presence of colonies after transformation but none in the negative control suggests that at least the native plasmid has been transformed succesfully.
- a- From Left to Right:
p15.07 DreamTaq #A (9 colonies) - 1kb ladder - p15.07 DreamTaq #A (1 colonies) - p15.07 DreamTaq #B (6 colonies) - b- From Left to Right:
of p15.07 DreamTaq #B (4 colonies) - p15.06 DreamTaq #A (3 colonies) - p15.01 -
p15.06 DreamTaq #B (1 colonies) - 1kb ladder - p15.06 DreamTaq #B (7 colonies) - c- From Left to Right:
p15.06 DreamTaq #B (2 colonies) - p15.01 - 1kb ladder - negatice control PCR (no matrix DNA) - d- zoomed view of two bands of figure 4b
- 4 colonies of p15.07, BbsI #A, 3:1 ratio
No band was visible. Several explanations are possible:06/08
We performed again the colony PCR on the same colonies with a different DreamTaq Enzyme. PCR analysis on 1% agarose 0.5X TAE gel.
Figure 4: Confirmation of Insertion of RibADET operon in p15.01 by Electrophoresis
From these results, we decided to investigate the different tubes (3) of DreamTaq enzyme to look for a lost of function.
So, we PCRed two of our gBlocks (RibE and T25) with the three different DreamTaqs (Extension time: 2.00min).
Then, to see whether the amplification worked of not, we run our PCR products on an 1% agarose gel.
Here is a picture of the gel after 20min at 100V:
According to these results, we concluded that two among the three DreamTaqs did not work. It could explain why our precedent colony PCR failed miserably.
We launched overnight cultures of: