Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"

Line 1,635: Line 1,635:
 
     8 x RibT25 - generuler 1kb - 8 x RibT48</li></i><br>
 
     8 x RibT25 - generuler 1kb - 8 x RibT48</li></i><br>
 
</ul>
 
</ul>
<br><br>
+
<br>
 
Knowing that we finished the first phusion MasterMix for the seventh RibT25 PCR mix and used another one for the last RibT25 and for the eight RibT48, we suspected that the first MasterMix we used was not working anymore, and thus could explain these days PCR failures.<br><br>
 
Knowing that we finished the first phusion MasterMix for the seventh RibT25 PCR mix and used another one for the last RibT25 and for the eight RibT48, we suspected that the first MasterMix we used was not working anymore, and thus could explain these days PCR failures.<br><br>
  
 +
 +
 +
 +
<br><br><h1 class="date">18/08</h1><br><br>
 +
 +
PCR amplification of RibD, RibE, RibT25 and RibT48 (two mix for each, 1µL of dNTPS was added to increase the yield, 50µL of mix per tube).<br>
 +
For annealing , we used respectively 60.5, 55, 64 and 62.2°C for RibD, RibE, RibT25 and RibT48.<br>
 +
<img width="25%" src="https://static.igem.org/mediawiki/2015/d/d6/PB_notebookB2_pic37.jpg"/><br>
 +
<b>Figure 268: </b><i>Electrophoresis of Rib gBlocks PCR products</i><br>
 +
<i>From left to right: <br>
 +
RibD x2 - RibE x2 - generuler 1kb - RibT25 x2 - RibT48 x2</i><br><br>
  
  

Revision as of 14:01, 24 August 2015



13/07



  • Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.
  • Dilution in water and PCR amplification, using the following protocol:
    • 1 μL gBlock (0.1 to 1ng)
    • 1 μL forward primer (10 μM)
    • 1 μL reverse primer (10 μM)
    • 22 μL DNAse/RNAse free water
    • 25 μL LifeTech MasterMix (2X)

    RibA + o15.001 (GCGCCCGAAGACTTATGCAG) + o15.002(GGCCCCGCGCATATGAAG)
    RibD + o15.003(CGCTATAGAAGACTTGAGAAGATCTG) + o15.004(GCGCGGCACCACATATGAAG)
    RibE + o15.005(CGGCTATAGAAGACTTGCGC) + o15.006(CGCGCCGGCATATGAAGA)
    RibT25 + o15.007(CCGCGTATAGAAGACTGCTAGA) + o15.008(CAGCAGCATATGAAGACAACCC)
    RibT48 + o15.009(GCGGTATAGAAGACTGCTAGAGA) + o15.010(CAGCAGCATATGAAGACAACCC)

    For each PCR reaction, a negative control without matrix DNA was prepared.


    12 cycles amplification, using the following parameters:
    time (min) temperature (°C) function
    3:00 98 melting
    0:30 98 melting
    0:30 52 annealing
    1:00 72 extension
    10:00 72 extension
    forever 12 storage
    PCR purification using QIAGEN kit
      PCR purification protocol
    • Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down
    • Transfer in a centrifugation column
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Add 700μL of washing solution
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Add 500μL of washing solution
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Put the column in a sterile 1.5mL microcentrifuge tube
    • Add 45μL of DNAse/RNAse free water on the membrane
    • Wait 2 minutes
    • Centrifuge 2min at 10000rpm
    • Discard the column, DNA is saved in water

Concentrations measured with a Nanodrop:
[PCR product with gBlock] (ng/μL) [PCR product without gBlock] (ng/μL)
RibA 3.5 3.4
RibD 6.4 3.3
RibE 5.0 3.7
RibT25 3.5 3.8
RibT48 8.7 3.3
Almost no difference between the PCR and their corresponding negative control.
It could be the fallout of the limited number of cycles. (We only used 12 cycles, as advised by IDT)
NEB Tm calculator gave really different Tm for the PCR primers than Geneious and IDT.
We decided to launch two PCR, both with 35 cycles, but with two different annealing
temperature: 52 and 64°C.



14/07



Launched the two different PCR with different Tm.

PCR with high annealing temperature, 35 cycles:
time (min) temperature (°C) function
3:00 98 melting
0:30 98 melting
0:30 64 annealing
1:00 72 extension
10:00 72 extension
forever 12 storage

PCR with low annealing temperature, 35 cycles:
time (min) temperature (°C) function
3:00 98 melting
0:30 98 melting
0:30 64 annealing
1:00 72 extension
10:00 72 extension
forever 12 storage

After PCR, we ran the PCR products on a TAE - 1% agarose gel (100V, 20min) to check if the amplification product correspond to the expected size of the gBlocks.

Figure 1: PCR amplification confirmation by electrophoresis
From the left to the right:
1kb Ladder, RibA, D, E, T25 and T48 amplified at 52°C and Rib A, D, E, T25 and T48 amplified at 64°C


The bands are not really specific and seems to be smeared over the gel.
However, we can see that the extremity of each band correspond approximatively
to the expected size of our parts, except RibD amplified at 64°C for which no band has been detected.

We purified our PCR product according to the previously used protocol, and then measure the DNA concentration using a Nanodrop.
Part Name PCR product amplified at 52°C concentration (ng/μL) PCR product amplified at 64°C concentration (ng/μL)
RibA 54.3 132.7
RibD 50.5 140.2
RibE 67.1 78.2
RibT25 63.6 136.0
RibT48 61.2 143.1


16/07



Annealing of o15.011 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAT) and o15.012 (CTAGATCCCCCAAGTCTTCGAAGACAAGCATGG) using the following protocol:
Annealing Protocol
  • Phosphorylation of the oligos
    • 5.6μL DNAse/RNAse free water
    • 6.0μL o15.011 (10µM)
    • 6.0μL o15.012 (10µM)
    • 2.0μL 10X T4 DNA ligase buffer
    • 0.4μL T4 PolyNucleotide Kinase Total: 20μL

  • incube 30min at 37°C
  • add 1μL of 1M NaCl
  • incube 5min at 95°C
  • let the mix cool down
  • use 2μL of the mix as a 10X solution

Inoculate LB + erythromycin (150ng/μL) with g15.21 containing pKV6.
Inoculate M17 + erythromycin (10ng/μL) with g15.13 containing pSIP411.
17/07
Miniprep of g15.13 and g15.21 as describe below:
Miniprep protocol using a QIAGEN kit
  • centrifuge an overnight culture of cells 10min at 4krpm
  • throw the filtrate
  • resuspend the pellet in 250μL of Cell Resuspension Solution then mix it
  • transfer it in a 1.5mL microcentrifuge tube
  • add 250mL of Cell lysis solution and mix by inverting several times
  • incube until the liquid is clear, maximum 5min
  • add 10μL of Alkalyne protease solution, mix by inverting several times and incube 3 to 4 min
  • add 350μL of Neutralisation Solution and mix by inverting several times
  • centrifuge 10min at 14krpm
  • add the supernatant in a column
  • centrifuge 1min, 14krpm, then throw the filtrat
  • add 750μL Washing Solution
  • centrifuge 1min, 14krpm, then throw the filtrat
  • add 250μL Washing Solution
  • centrifuge 2min, 14krpm, then throw the filtrat
  • centrifuge 1min, 14krpm
  • transfer the column in a sterile microcentrifuge 1.5ml tube
  • add 50μL of DNAse/RNAse free water right on the membrane of the filter, wait 1min
  • centrifuge 1min, 14krpm
  • throw the column, plasmid is saved in water

As g15.13 is a gram positive bacteria, we added 1mL of 10mg/mL Lysozyme at the same time that the cell lysis solution.
Measurement of DNA concentration

20/07



-Annealing of o15.072 (TCGACCATGCTTGTCTTCGAAGACTTGGGGGAG) and o15.073 (AATTCTCCCCCAAGTCTTCGAAGACAAGCATGG) thanks to the protocol used previously.
-PCR of pSIP411 ORI and resistance cassette (erythromycin) using o15.070 and o15.071.
We will call it pSIPnew to write clearer explanations.
The size of this fragment is 3.1kb, so the elongation phase was extended to 2min.
a negative PCR control was made at the same time (without matrix DNA).
PCR purification after the PCR and concentration measurement:
Concentration (ng/μL)
pSIPnew 99.0
negative control 0.0


21/07



Digestion of amplified band of pSIPnew and pKV6 with respectively XbaI/SalI and EcoRI/SalI using the following protocol.
Digestion Protocol
  • Prepare the following mix:
    • 4μL of Enzyme 1
    • 4μL of Enzyme 2
    • 4μL of FastAP
    • 12μL of Fast Digest buffer 10X
    • 1 to 3 μg of DNA
    • up to 120μL of water
  • mix by pipetting up and down
  • incube at 37°C, 10 min for FD, 45 min for regular enzymes
  • incube 10min at 70°C

For pSIPnew: SalI and XbaI, 30μL of DNA (99ng/μL), 66μL of water.
For pKV6: SalI and EcoRI, 10μL of DNA(270ng/μL), 86μL of water.

PCR purification of both digested pKV6 and pSIPnew
Measure the DNA concentration after PCR purification:
Concentration (ng/μL)
pSIPnew 60.8
pKV6 26.4

Ligation of annealed oligos o15.011 and o15.012 with digested pSIP411new and o15.072 and o15.073 with digested pKV6 using the following protocol
Ligation Protocol
  • Mix the following
    • vector 100ng
    • insert 300ng
    • 2µL T4 DNA ligase buffer 10X
    • 1µL T4 DNA ligase
    • up to 20µL of water
  • incubate 30 to 40 minutes at room temperature
For pKV6: 4µL of digested pKV6(26.4ng/µL), 7µL of annealed o15.072/o15.073, 6µL of water.
For pSIPnew: 2µL of digested pKV6(60.8ng/µL), 6µL of annealed o15.011/o15.012, 9µL of water.

pKV6 ligated with o15.072/o15.073 and pSIPnew ligated with o15.011/o15.012 will be respectively called p15.01 and p15.02.

Transformation of p15.01, p15.02, pKV6(miniprep), pSIP411(miniprep) and a negative control (no DNA) in NEB DH5α chemically competent cells
Heat Shock transformation protocol
  • Thaw frozen chemically competent cells (20µL aliquots) on ice for 10min.
  • add 2µL of ligation product (or 0.5µL of miniprep) and incubate the cells 30sec at 42°C.
  • put the cells back on ice for 2min.
  • add 200µL of LB to the cells and incubate 2 hours at 37°C.
  • plate the cells on LB + erythromycin (150µg/mL) or LB + erythromycin (10µg/mL), incubation at 37°C overnight.



22/07



Transformation results
Transformed product pKV6 pSIP411 p15.01 p15.02 negative control
Growth Results
  • (ery 150µg/mL):
    500 colonies, no background
  • (ery 10µg/mL):
    no growth
  • (ery 150µg/mL):
    lawn of bacteria
  • spreading of 170µL:
    41 isolated colonies -> isolation of three transformants: T1, T2 and T3
  • spreading of 50µL:
    3 colonies on a lawny background
  • (ery 10µg/mL):
    lawn of bacteria
  • (ery 150µg/mL):
    lawny background
no growth


23/07



Preparation of DH5α Electrocompetent cells, 50 tubes of 100µL.
Electrocompetent Cells Preparation Protocol
  • Inoculate two 250mL LB flasks with 100µL of an overnight culture of DH5α
  • incubate until the the DO600 reach 0.5 to 0.7
  • place the cultures on ice for 15 minutes
  • pour the culture in cold sterile 50mL falcon tubes
  • centrifuge them for 10 minutes at 6000rpm
  • throw the supernatant
  • resuspend the cells in 50mL cold distilled water
  • centrifuge them for 10 minutes at 6000rpm
  • throw the supernatant
  • resuspend the cells in 25mL cold distilled water
  • centrifuge them for 10 minutes at 6000rpm
  • throw the supernatant
  • resuspend the cells in 12.5mL cold 10% glycerol
  • centrifuge them for 10 minutes at 6000rpm
  • throw the supernatant
  • resuspend the cells in 5mL cold 10% glycerol
  • make aliquots of the desire volume in microcentrifuge tubes and freeze them at -80°C

overnight cultures of 3 p15.01 transformants.

24/07



Miniprep of the 3 overnight cultures of p15.01 transformants T1, T2 and T3(respective concentration: 204.8, 160.7 and 267.7 ng/µL).
Digestion of pKV6(negative control) and p15.01 with BbsI and Eco31I to control the insertion of the two BbsI sites in p15.01.
Analytical digestion protocol
  • Prepare the following mix:
    • 2µL 10X Digestion buffer
    • 0.5µL Eco31I
    • 0.5µL BbsI
    • 2µL of DNA (200ng)
    • 15µL water
  • incube 1h at 37°C
HERE IS THE PICTURE OF THE CORRESPONDING GEL

Both T2 and T3 transformants present the same bands as pKV6, whereas T1 shows 3 bands at 2.7kb, 1.7kb and 1.4kb.

Oligos used for sequencing are o15.097(CGGTAGAGCTCCCTTCTATGC) and o15.098(CTGGCACGACAGGTTTCCC).
Overnight of T1 in LB+ery(150µG/mL).

Dialyse of both ligation products(p15.01 and p15.02) and both native plasmids (pKV6 and pSIP411) on 0.025µm cellulose filter for 20 minutes.

Transformation of DH5α by electroporation with the previously ligated p15.01 and p15.02.
Electroporation Protocol
  • Thaw electrocompetent cells on ice
  • Add 2µL of ligation product or 0.5µL of native plasmid to the cells
  • Transfer the cells in an 0.2mm electroporation cuvette
  • put the cuvette in the electroporation device and pulse the cells at 2.5kV, 200 Ohms and 25µF
  • add 200µL of LB right after pulsing
  • recover 2 hours at 37°C
  • plate 200µL and 50µL of the cells on LB + erythromycin (200µg/mL), incubate overnight at 37°C
Cells were plated on two LB + erythromycin (200µg/mL) plates. The first was inoculated with 50µL, the second with µL.

25/07



Transformation results
Transformed product pKV6 pSIP411 p15.01 p15.02 negative control
Growth Results lawn of unrecognized bacteria with dense colonies
  • 200µL:
    11 single colonies
  • 50µL:
    7 single colonies
  • 200µL:
    32 single colonies
  • 50µL:
    0 colony
  • 200µL:
    thin lawn of unrecognized bacteria with dense colonies
  • 50µL:
    thin lawn of unrecognized bacteria
thin lawn of unrecognized bacteria
As the negative control showed a growth, we discarded these results and decided to perform a second transformation (dialyse of the previous day ligation products + transformation) with the same ligation products, using the same protocol. p15.01 product was lost during dialysis. Time constants were 5.3 for all the pulses. pKV6 was plated on LB + erythromycin (200µg/mL); pSIP411 and p15.02 were plated on LB + erythromycin (150µg/mL) and LB + erythromycin (200µg/mL).

27/07



Transformation results
Transformed product pKV6 pSIP411 p15.01 p15.02 negative control
Growth Results 158 single colonies
  • 200µg/mL:
    thin lawn of unrecognized bacteria
  • 150µg/mL:
    thin lawn of unrecognized bacteria
lost during dialysis
  • 200µg/mL:
    thin lawn of unrecognized bacteria
  • 150µg/mL:
    thin lawn of unrecognized bacteria
no growth
To prevent the transformation of the native pSIP411 (non-digested or re-circularized), we decided to PCR the 3kb fragment containing the ORI and the erythromycin resistance gene, digest it with SalI/XbaI, PCR purify it and then gel purify it. This would give us only the fragment we want to ligate and thus prevent background transformants to appear.

For the PCR, o15.070(AAAAACCGCAGGGAGGCAAACAATGA) and o15.071(CGGATTAACGTTAAGAACTCTATTGAAGG) were used to amplify the 3 kb fragment, with an annealing temperature of 69°C (according to NEB Tm calculator) and an elongation time span of 2 minutes.
All the PCR purified product was run on an 1% agarose gel, and gel extraction was performed on the band of approximative size 3kb, according to the following protocol.
Gel Extraction Protocol with QIAGEN kit
  • add three times the volume of QG solubilisation buffer with one volume (=mass) of gel extracted
  • incubate 10 minutes at 50°C, vortex every 2 or 3 minutes, until the gel is dissolved
  • transfer in a provided purification column, centrifuge 1 minute at 14000rpm then discard the filtrat
  • add 500µL of solubilisation buffer, centrifuge 1 minute at 14000rpm then discard the filtrat
  • add 750µL of washing buffer
  • centrifuge 1 minute at 14000rpm then discard the filtrat
  • add 500µL of washing buffer
  • centrifuge 1 minute at 14000rpm then discard the filtrat
  • centrifuge 1 minute at 14000rpm then discard the filtrat
  • put the column in a clean 1.5mL microcentrifuge tube
  • add 45µL of DNAse/RNAse free water right on the membrane of the column
  • wait a couple of minutes and then centrifuge 1 minute at 10000rpm
  • discard the column, DNA is saved in water

Concentration measured with Nanodrop was INSERT CONCENTRATION HERE

To get a fresher batch of annealed oligos, we decided to anneal them again, using the same protocol. (o15.011+o15.012 and o15.072+o15.073). The three minipreps from p15.01 transformants were send to sequencing thanks to GATC LightRun NightXpress service.
5µL (~100ng/µL) of all three minipreps were mixed with o15.097 (forward primer, CGGTAGAGCTCCCTTCTATGC) or o15.098 (reverse primer, CTGGCACGACAGGTTTCCC).


28/07



Measurement of DNA concentration after digestion/gel extraction:
Concentration (ng/μL)
pKV6 44.8
pSIP411 3kb fragment 79.5


Ligation, dialyse and transformation by electroporation of pSIP411 3kb band + o15.011/o15.012, digested pKV6+o15.072/o15.073 and both native plasmids (pKV6 and pSIP411).
Cells were then plated with bids on LB+erythromycin (200µg/mL) and incubated at 37°C.

Sequencing results: sequencing confirm the insertion of the two BbsI sites in the T1 transformant(=p15.01 plasmid).
Both T2 and T3 did not contain the insert.
T1 was glycerol stocked for long-term conservation, and renamed as g15.49.


30/07



Transformation results
Transformed product pKV6 pSIP411 p15.01 p15.02 negative control
Growth Results thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria thin lawn of unrecognized bacteria


Golden Gate assembly of RibADET25 and RibADET48 in p15.01 and transformation of chemically competent NEB Turbo ''E.coli''. The two new plasmids are respectively named p15.06 and p15.07.
Golden Gate was performed according to the following protocol:
Golden Gate protocol
  • Mix the following in a PCR tube:
    • 1µL T4 DNA ligase buffer
    • 1µL BbsI HF
    • 2µL NEB GoldenGate Buffer 10X
    • 200ng backbone
    • 2:1 molarity ratio (insert:vector) of each insert
    • up to 20µL with water
  • incubate using the following:
  • Time (minute) Temperature (°C) Function
    3 37 FUNCTION
    4 16 FUNCTION
    5 50 FUNCTION
    5 80 FUNCTION
    storage 12 FUNCTION

Heat shock transformation of both Golden Gate products, p15.01(miniprep), p15.02(ligation product) and pKV6. Recovery two hours at 37°C and plating on LB + erythromycin (150µg/mL). Inoculated LB with NEB Turbo, overnight at 37°C

30/07



Transformation results
Transformed product pKV6 pSIP411 p15.01 p15.02 p15.06 p15.07 negative control
Growth Results 204 isolated colonies (0.5 mm) 137 isolated colonies (0.5 to 1 mm) half lawn, half isolated colonies (~500) lawn lawn and some isolated colonies ~1000 tiny isolated colonies no growth


Striked a sample of p15.02 lawn on LB + ery (150µg/mL).
Striked a sample of p15.06 lawn on LB + ery (150µg/mL).
Striked a single colony of p15.07 on LB + ery (150µg/mL).
Incubated overnight at 37°C.
Seeing all the electroporation results so far, we decided to prepare an new batch of electrocompetent NEB Turbo (using the same protocol).

Overnight culture of g15.49 (containing p15.01) in LB + ery (150µg/mL).



05/08



Plating Results:
p15.02 p15.06 p15.07
big single colonies big single colonies big single colonies
Inoculated 5mL LB + ery (150µg/mL) with 3 p15.02 colonies, 4 p15.06 colonies and 3 p15.07 colonies, and a negative growth control (non-inoculated LB), incubated overnight at 37°C.
Miniprep of the g15.49 overnight => p15.01 at 330ng/µL.

02/08



All the cultures incubated on the 01/08 grew, except the negative control, and were minipreped.
The three p15.02 transformants were sent for sequencing with o15.099 (forward primer, GCCAGCGGAATGCTTTCATCC) or o15.100 (reverse primer, CATGAATTAGTCTCGGACATTCTGC).

03/08



Restriction Digestion of p15.01 with Eco31I and BbsI (using the digestion protoccol) and PCR purification to remove the enzymes.
Picked 10 single colonies from both p15.06 and p15.07 and launched overnight cultures in LB + ery (150µg/mL).


04/08



Miniprep of all the overnight cultures from clones of p15.06 and p15.07.
Restriction digestion with Eco31I of 6 p15.06 and p15.07 minipreped.
p15.06 and p15.07 restriction analysis should produce 6 fragments (first and second may be overlapping) (2.77, 2.7, 1.7, 1.3, 0.9 and 0.6),
whereas p15.01 restriction analysis should only produce two fragments(2.7, 3.4)



Figure 2: Restriction analysis of p15.01, p15.06 and p15.07 with Eco31I on 1% agarose gel
From left to right: p15.01 non digested, p15.01 digested, p15.06 (6 colonies), p15.07 (2 colony), generuler 1kb, p15.07 (6 colonies)


All the digested products are presenting only two bands (and some bands likely to come from Eco31I star activity)us are not containing the four inserts.

We decided to perform an other golden gate/dialyse/transformation with p15.01, p15.06 and p15.07.
According to several advice we received, we tried two different golden gate protocols, the first one using the 2:1 insert:backbone ratio, the second using a 3:1 ratio.
Time constants for each electroporation was about 5.2 or 5.3 msec.
As one tube of BbsI enzyme mysteriously appeared in the fridge, we tested both (A and B).
After one hour of recovery, two volumes (50µL and 170 µL) of each transformed cells were plated on LB + ery (150µg/mL) and incubated overnight at 37°C.


05/08



Transformation results
Transformed product p15.01 p15.06, BbsI #A, 3:1 ratio p15.06, BbsI #B, 2:1 ratio p15.07, BbsI #A, 3:1 ratio p15.07, BbsI #B, 2:1 ratio Golden Gate negative control (golden gate reaction without inserts) negative growth control
more than 500 colonies (1 to 3mm in diameter)
  • 50µL:

  • 0 colony
  • 170µL:

  • 5 colonies
  • 50µL:

  • 16 colonies
  • 170µL:

  • 53 colonies
  • 50µL:

  • 4 colonies
  • 170µL:

  • 65 colonies
  • 50µL:

  • 29 colonies
  • 170µL:

  • 152 colonies
  • BbsI #A, 170µL:

  • 0 colony
  • BbsI #B, 170µL:

  • 0 colony
  • 50µL:

  • 0 colony
  • 170µL:

  • 5 colonies
  • 50µL:

  • 0 colony
  • 170µL:

  • 0 colony


To control the insertion, we used colony PCR with o15.097(CGGTAGAGCTCCCTTCTATGC) and o15.098(CTGGCACGACAGGTTTCCC). The colony PCR were performed on 10 single colonies of p15.06 #B, 10 single colonies of p15.07 # A, 10 single colonies of p15.07 #B and 3 single colonies of p15.06 #A.
If the insertion worked, PCR should amplifiate a 4.8kb band, whereas if the insert is not present, a 0.6kb band should be observed.
Colony PCR protocol
  • Prepare the following mix in this order:
    • up to 20µL water
    • 1µL DNA Template or some cells from a single colonies (save some cells on a plate)
    • 0.5µL Forward Primer (10µM)
    • 0.5µL Reverse Primer (10µM)
    • 2µL dNTPs mix (10µM)
    • 2µL DreamTaq Green Buffer (10X)
    • 0.5µL DreamTaq (5U/µL)
  • Run a PCR with a longer first high temperature phase (5 to 8 more minutes) to lyse the cells, and extend the elongation phase to 1 min/kb

PCR analysis on 1% agarose 0.5X TAE gel.


Figure 3: Confirmation of Insertion of RibADET operon in p15.01 by Electrophoresis
  • a- From Left to Right:
    p15.07 DreamTaq #A (8 colonies) - 1kb ladder - p15.07 DreamTaq #A (2 colonies) - p15.07 DreamTaq #B (6 colonies)

  • b- From Left to Right:
    p15.06 DreamTaq #B (8 colonies) - 1kb ladder - p15.06 DreamTaq #B (2 colonies) - PCR negative control (no matrix DNA) -

  • c- From Left to Right:
    p15.07 DreamTaq #B (4 colonies) - 1kb ladder - p15.06 DreamTaq #A (3 colonies) - p15.01


  • No band was visible. Several explanations are possible:
    • Colony PCR failed
    • The colonies did not contain p15.01, p15.06 or p15.07, however the presence of colonies after transformation but none in the negative control suggests that at least the native plasmid has been transformed succesfully.
    Thus, we decided to do the experiment again the next day.

    06/08



    We performed again the colony PCR (with o15.097 and o15.098) on the same colonies with a different DreamTaq enzyme. PCR analysis on 1% agarose 0.5X TAE gel.


    Figure 4: Confirmation of Insertion of RibADET operon in p15.01 by Electrophoresis
    • a- From Left to Right:
      p15.07 DreamTaq #A (9 colonies) - 1kb ladder - p15.07 DreamTaq #A (1 colonies) - p15.07 DreamTaq #B (6 colonies)

    • b- From Left to Right:
      of p15.07 DreamTaq #B (4 colonies) - p15.06 DreamTaq #A (3 colonies) - p15.01 -
      p15.06 DreamTaq #B (1 colonies) - 1kb ladder - p15.06 DreamTaq #B (7 colonies)

    • c- From Left to Right:
      p15.06 DreamTaq #B (2 colonies) - p15.01 - 1kb ladder - negatice control PCR (no matrix DNA)

    • d- zoomed view of two bands of figure 4b


    Even when the gel quality is not really good, we observed a strange 8kb band in most of the wells and also in the negative insertion control. These results mean that the either the PCR failed or that the inserted plasmid is not the good one.
    From these results, we decided to investigate the different tubes (3) of DreamTaq enzyme to look for a lost of function.

    So, we PCRed two of our gBlocks (RibE and T25) with the three different DreamTaqs (Extension time: 2.00min).
    Then, to see whether the amplification worked of not, we run our PCR products on an 1% agarose gel.
    Here is a picture of the gel after 20min at 100V:


    Figure 5: PCR amplification using three DreamTaq mixes unraveled by electrophoresis

    According to these results, we concluded that two among the three DreamTaqs did not work. It could explain why our precedent colony PCR failed miserably.

    We launched overnight cultures (LB + ery 150µg/mL) of:
    • 4 colonies of p15.07, BbsI #A, 3:1 ratio
    • 4 colonies of p15.07, BbsI #B, 2:1 ratio
    • 2 colonies of p15.06, BbsI #A, 3:1 ratio
    • 4 colonies of p15.06, BbsI #B, 2:1 ratio


    07/08



    Because of the poor digestion capacity we observed in BbsI, we investigated on the net if some other people had problems with the NEB BbsI enzyme. [This website] explained that they detected that "BbsI supplied by NEB (an isoschizomer of BpiI) loses activity extremely quickly and has a lot of star-activity". Using this information, we thought about using BpiI instead of BbsI.
    To confirm that BpiI would digest our plasmid the same way than BbsI, we digested p15.01 with BpiI to see if it would produce the same three bands than BbsI.
    Figure 6 shows the electrophoresis result of p15.01 after digestion with Eco31I and BpiI:

    Figure 6: Digestion of p15.01 with BpiI

    The 3 expected bands (2.6, 1.7 and 1.4kb) are clearly visible, and no noisy band is detected at the same time, suggesting a low star activity. Thus, we decided to use BpiI to perform the next reactions.

    Miniprep of the 14 overnight cultures and restriction analysis of their plasmid with BpiI and Eco31I.
    Here is a simulation of an electrophoresis:

    Figure 7: Electrophoresis simulation of the restriction analysis of transformant's plasmid with BpiI and Eco31I
    From the left to the right:
    Undigested p15.01, digested p15.01, p15.06 and p15.07 (Eco31I and BpiI)


    Restriction analysis result after 25 min (100V, 1% agarose TAE gel):

    Figure 8: Electrophoresis of the restriction analysis of transformant's plasmid with BpiI and Eco31I
    From the left to the right:
    p15.06 #A(2 transformants), p15.06 #B(4 transformants), generuler 1kb, p15.07 #A (4 transformants), p15.07 #B (4 transformants),

    No wheel was showing the expected bands showing the insertion of the four gBlocks in the backbone.
    All the wheels were presenting various coiled variants of the backbone and the non-inserted digested backbone.


    08/08



    Miniprep of g15.49. Extraction of 53.5ng/µL of p15.01.

    Golden Gate assembly of RibA, RibD, RibE and RibT25 or RibT48 in p15.01, with both 2:1 and 3:1 molarity ratios.
    Negative control is constituted of a digested p15.01 with BpiI and ligated without any digested insert.
    Instead of BbsI, we used BpiI.
    3µL of each Golden Gate products were transformed in electrocompetent NEB turbo E.coli.
    Cells were recovered one hour in LB at 37°C, and two volume (50µL and 170µL) were plated on LB + 150µg/mL of erythromycin.


    To check whether the assembly is working or not, we ran a gel to see if the Golden Gate is producing some expected bands.
    Here is a picture after 20 minutes of migration:

    Figure 9: Electrophoresis of p15.01, RibA, D, E and T after Golden gate assembly
    From the left to the right:
    generuler 1kb - p15.06 1:2, p15.07 1:2, p15.06 1:3, p15.07 1:3, p15.01



    PUT HERE A SIMULATION OF THE LIGATION




    09/08



    Miniprep of the two overnight cultures of g15.49: extracted 108 and 200 ng/µL.

    Transformation results (from 08/08 transformation)
    Transformed product p15.06, 2:1 ratio p15.06, 3:1 ratio p15.07, 2:1 ratio p15.07, 3:1 ratio negative control
    • 50µL:

    • 0 colony
    • 170µL:

    • 12 colonies
    • 50µL:

    • 0 colony
    • 170µL:

    • 0 colony
    • 50µL:

    • 1 colony
    • 170µL:

    • 16 colonies
    • 50µL:

    • 4 colonies
    • 170µL:

    • 7 colonies
    • 50µL:

    • 0 colony
    • 170µL:

    • 0 colony


    We performed a colony PCR on 8 colonies from p15.06 1:2, p15.07 1:2, p15.07 1:3 and 1 colony of p15.01 (from 04/08 transformation), using o15.097 and o15.098.
    Instead of preparing ourselves the DreamTaq Mix, we used a 2X DreamTaq Master Mix, to which we only add both forward and reverse primers.
    Cells were saved on Lb + ery (150 µg/mL).
    Lyse was performed during 8 minutes, and elongation time span was extended to 3.3 minutes (instead of 6 - 1min/kb - human error...)


    Figure 10: Insertion control by colony PCR and electrophoresis
    • a-From left to right:
      p15.07 1:2 molarity ratio (8 colonies) - generuler 1kb - p15.07 1:3 molarity ratio (8 colonies)

    • b-From left to right:
      generuler 1kb, p15.01, p15.06 1:2 (8 colonies)




    10/08



    Colony PCR on 16 p15.06 (1:2) colonies, 16 p15.07 (1:2) colonies and 16 p15.07 (1:3) colonies.
    Elongation time span was extended to 3.30 minutes, and annealing was performed at 64°C.
    Because of a human mistake, thermocycler lid was inversed, letting the caps opening themselves when temperature increased. The PCR products were lost.

    Restriction digestion of p15.01 by BbsI or BpiI(Fast Digest), then by Eco31I.

    Figure 11: Electrophoresis of p15.01 after restriction digestion
    From left to right:
    non-digested p15.01 - p15.01 digested by BbsI (A and B) + Eco31I - p15.01 digested by BpiI + Eco31I

    Though BbsI is a "NEB time saver protocol enzyme" but 5 to 15 minutes is not long enough for plasmid digestion.


    11/08



    PCR amplification of RibA, RibD, RibE and both RibT, elongation time was extended to 2.30 minutes and annealing temperature was 64°C.
    As the previous day, caps opened during the PCR because the thermocycler lid was inversed...

    Second PCR amplification of Rib gblocks. Final volume was 100µL, elongation time 2.30 minutes and annealing temperature was 64°C.
    Electrophoresis was performed to control the gBlocks amplification.

    Figure 12: Rib gblocks amplification (64°C annealing) control by electrophoresis
    From left to right:
    generuler 1kb - RibA - RibD - RibE - RibT25 - RibT48


    It clearly appeared that something was wrong the amplification. Because of the absence of band for RibA and the double band for RibD, we decided to perform a third PCR using a lower annealing temperature (55°C).

    Figure 13: Rib gblocks amplification (55°C annealing) control by electrophoresis
    From left to right:
    generuler 1kb - RibA - RibD - RibE - RibT25 - RibT48


    RibA, RibE and RibT48 were scarcely visible and RibD and RibT25 were presenting two bands.
    Using the different gel pictues we had, we decided to perform a fourth PCR amplification using for each gBlock the annealing temperature which gave the brightest and the sharpnest bands.
    For the amplification, we used the 60°C for RibA, RibD and RibT25, and 55°C for RibE and RibT48.

    Preparation of electrocompetent NEB turbo, saved in 200µL aliquots at -80°C.

    12/08




    Figure 14: Rib gblocks amplification (launched the 11th) control by electrophoresis
    From left to right:
    generuler 1kb - RibA - RibD - RibE - RibT25 - RibT48


    All the bands correspond to the expected size of the gBlocks, but RibA for which no band was visible.

    Thus, we decided to perform a gradient PCR (five tubes spread from 52°C to 64°C) on RibA to determine what was the best (or a least a good) temperature for annealing.

    Figure 15: RibA amplification control by electrophoresis
    From left to right:
    generuler 1kb - RibA (Tm=52) - RibA (Tm=55) - RibA (Tm=58) - RibA (Tm=61) - RibA (Tm=64) -


    According to these results, we assumed that the five gblocks were there.

    PCR purification of the five gBlocks. For the multiple RibA, we purified them separately, giving four stocks of amplified gBlocks.

    Digestion of p15.01 and the Rib gBlocks separately, with BpiI (final volume = 30µL, about 100ng of DNA per tube). The digestion products were then PCR purified to get rid of the enzymes.



    13/08



    Ligation of p15.01 + RibA, RibD, RibE and RibT25 with 2:1 and 3:1 molarity ratio. Same for T48.
    Each ligation mix contained 20ng of the backbone, for a final volume of 20µL.
    Thus, the 2:1 mix contained 10ng of RibA, 12ng of RibD, 9ng of RibE and 6ng of RibT.
    3:1 mix contained respectively 15, 13, 13 and 8ng of RibA, RibD, RibE and RibT.

    All the ligation products were dialysed during 40 minutes.

    Transformation by electroporation of the four ligation products and for both digested and undigested p15.01 (5µL ligation product in 200µL electrocompetent cells).
    Time constant was 5.3 or 5.4 for all the transformations.

    Cells were recovered 2 hours in LB and then plated on LB + ery 150µg/mL.


    14/08



    Colony PCR of 15 colonies from each transformation. Annealing temperature was 64°C and elongation set to 3 minutes.

    Figure 16: Colony PCR of p15.06 (1:2 ratio) transformants
    From left to right:
    p15.01 (negative control) - 12 p15.06 (1:2) colonies - generuler 1kb - 3 p15.06 (1:2) colonies



    Figure 17: Colony PCR of p15.06 (1:3 ratio) transformants
    From left to right:
    p15.01 (negative control) - 8 p15.06 (1:3) colonies - generuler 1kb - 7 p15.06 (1:3) colonies



    Figure 18: Colony PCR of p15.07 (1:2 ratio) transformants
    From left to right:
    p15.01 (negative control) - 8 p15.07 (1:2) colonies - generuler 1kb - 7 p15.07 (1:2) colonies



    Figure 19: Colony PCR of p15.07 (1:3 ratio) transformants
    From left to right:
    p15.01 (negative control) - 8 p15.07 (1:2) colonies - generuler 1kb - 7 p15.07 (1:2) colonies


    On all the gels, but p15.06 1:3, one can clearly see that all the bands are about 600bp heavy, as the negative control of insertion (p15.01).
    For p15.06 1:3, some bands are absent. After investigation, we figured out that the elongation time for the DreamTaq was 1kb/min instead of 30 seconds. Regarding to this information, we thought that maybe no band was visible because the insert was present but as the elongation time span was not long enough, the exponentially amplification could not work.
    To control these results, we launched overnight cultures of the four colonies corresponding to the absent bands (1, 6, 7 and 9).

    To obtain high yield of our five gBlocks, we performed a PCR using the optimal Tm we determined so far.


    Figure 20: Rib gBlocks PCR amplification
    From left to right:
    generuler 1kb - RibA - RibD - RibE - RibT25 - RibT48


    Even with such an ugly gel (a very old stock of agarose was used), one can clearly see that four of the five gBlocks are correctly amplified. RibE expected size is 0.9kb, here an 1.5 and a 0.5 bands are visible.

    To determine the optimal Tm for RibE amplification, we performed a gradient PCR from 55°C to 64°C.

    Figure 21: RibE gradient PCR amplification
    From left to right:
    generuler 1kb - RibE amplified with the respective Tm: 55, 55.6, 56.7, 58.4, 60.3, 62.2, 63.3 and 64°C.


    One can clearly see that only the two first wheels are showing really visible bands.
    These two PCR products were PCR purified and saved for later use.

    To get more of

    15/08



    Miniprep of the four overnight cultures and electrophoresis of the extracted DNA.
    Restriction analysis of the plasmid using BpiI and Eco31I.

    Figure 22: Restriction analysis of p15.06 transformants
    From left to right:
    generuler 1kb - p15.01 (negative control) - Transformant 1 - Transformant 2 - Transformant 3


    The digestion profile is showing no difference with the negative control. It meant that none of these three transformants contained the inserts.

    PCR amplification of RibD (o15.003+o15.004), RibE (o15.005+o15.006) and both ribT25/48(o15.007+o15.008/o15.009+o15.010).

    Figure 23: Electrophoresis of Rib gBlock amplification
    • a-From left to right:
      generuler 1kb - 2 x RibD - 2 x RibE

    • b-From left to right:
      generuler 1kb - 2 x RibD - 2 empty wheels - 2 x RibE


    RibD was presenting a second amplification band and RibE, T25 and T48 were all not visible.
    We launched an other PCR for RibD and RibE using a different phusion master mix.

    Figure 24: Electrophoresis of digested an undigested p15.01(BpiI) and RibD and E amplification control
    From left to right:
    generuler 1kb - undigested p15.01 - digested p15.01 - 2 x RibE - RibD


    As previously, RibD was presenting non expected bands. Geneious mismatch tool allowed us to look for non specific binding which could explain such a result. Allowing up to 8 mismatches, three other binding were detected, corresponding approximately to the size of the bands detected in the gel.

    PCR of the gBlocks with DMSO (1.5µL for 50µL reaction mix).


    16/08



    15/08 gBlocks PCR amplification analysis by electrophoresis.

    Figure 25: gBlocks PCR amplification control by Electrophoresis
    From left to right:
    generuler 1kb - RibA - RibD - RibE - RibT25 - Ribt48


    Gradient PCR amplification of RibD (annealing temperature from 52 to 65°C, total volume 20µL). Elongation time span was extended to 1.30 minutes.(overnight)

    17/08



    Electrophoresis of RibD gradient PCR.

    Figure 26: Electrophoresis of RibD amplification with eight annealing temperature
    From left to right:
    generuler 1kb - RibD (52 - 53 - 54.5 - 57 - 60 - 62.4 - 64 - 65°C)


    As this gel was not presenting any band and we were short in amplified gBlocks, we decided to amplify all of them again.
    As several PCR on the lab (for different teams) were not working, we suspected that maybe some phusion MasterMix were compromised.

    Gradient PCR amplification (Tm from 52 to 65°C : 52 - 53 - 54.5 - 57 - 60 - 62.4 - 64 - 65°C) of RibD, RibE and both RibT. Two phusion MM were used to prevent a negative result due to nonfunctional phusion MasterMix. Elongation time was extended to 1.30 minutes.


    Figure 27: Electrophoresis of RibD, RibE, RibT25 and RibT48 after gradient PCR amplification
    • a-From left to right:
      generuler 1kb - 8 x RibD - 8 x RibE

    • b-From left to right:
      8 x RibT25 - generuler 1kb - 8 x RibT48


    Knowing that we finished the first phusion MasterMix for the seventh RibT25 PCR mix and used another one for the last RibT25 and for the eight RibT48, we suspected that the first MasterMix we used was not working anymore, and thus could explain these days PCR failures.



    18/08



    PCR amplification of RibD, RibE, RibT25 and RibT48 (two mix for each, 1µL of dNTPS was added to increase the yield, 50µL of mix per tube).
    For annealing , we used respectively 60.5, 55, 64 and 62.2°C for RibD, RibE, RibT25 and RibT48.

    Figure 268: Electrophoresis of Rib gBlocks PCR products
    From left to right:
    RibD x2 - RibE x2 - generuler 1kb - RibT25 x2 - RibT48 x2