Team:Hamburg/Basic Part
Basic Parts
miRNA2911
The miRNA2911 plays the central role in our project. In reference to our ultimate goal it shall be combined with a light inducible promoter system to trigger the miRNA production accurately. In the lab we managed a composite BioBrick only with a constitutive promoter yet (constitutive promoter and miRNA).
BioBrick state: We validated the miRNA2911 BioBrick by sequencing and submitted it to the registry.
Sequence: (Prefix and Suffix)
5'
GAATTCGCGGCCGCTTCTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG
3'
Biological context: Lonicera japonica or the Japanese honeysuckle plant is a well-known Chinese herb and has been used to effectively treat influenza infection for thousands of years. The group around Zhou [1] found out that the major portion of detected miRNAs in this plant is being degraded by boiling and only miRNA2911 stayed resistant and active in a decoction. Throughout a bioinformatical prediction and luciferase reporter assays they showed that miRNA2911 has antiviral properties by targeting various Influenza A viruses (IAV), e.g. H1N1, H5N1, H7N9. miRNA2911 is highly stable because of its folding and elevated levels could be detected in peripheral blood and lung tissues of mice after gavage feeding of the honeysuckle decoction.
GroEL
After the miRNA production is conducted in a sufficient amount, a cell lysis is intented to release this product. Therefore we employed a GroEL promoter sequence, which is active at higher temperatures (42°C). Regarding our ultimate goal, an expression of a cell lysis protein (e.g. PezT) follows. We designed a composite part of GroEL with a blue pigment to verify its heat-induction ability (GroEL promoter and blue pigment).
BioBrick state: We submitted the GroEL BioBrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.
Sequence: (Prefix and Suffix, RBS, Pribnow sequence)
5'
GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGTAGCGGCCGCTGCAG
3'
Biological context: The GroEL promoter is a promoter from the GroE operon which can be found for example in E. coli. When cells are shifted from low to high temperature the GroEL promoter gets activated and genes under control of this promoter will be expressed. The heat shock response is universal and heat shock proteins are highly conserved [2].
- Zhou Z, Li X, Liu J, et al. Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses. Cell Res. 2015;25(1):39-49.
- Deborah W. Cowing et al. Consensus sequence for Escherichia coli heat shock gene promoters. Prot. Nat. Sci. U.S.A. 1984; vol. 82, pp. 2679-2683.