Team:Hamburg/Composite Part

Composite Parts

constitutive promoter and miRNA

Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as an important intermediate step. It is a composite part of our basic part miRNA2911 and the standard promotor BBa_J23100 (figure 2).

Fig. 1: Future BioBrick regarding our ultimate goal

BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.

Fig. 2: Our BioBrick as an important intermediate step

Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)

5'

GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG

3'

GroEL promoter and blue Pigment

Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create an intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part GroEL and a blue pigment (BBa_J23100) (figure 4). Future work would target a BioBrick of GroEL and PezT.

Fig. 3: Future BioBrick regarding our ultimate goal

BioBrick state: We did not submit the GroEL and blue pigment biobrick to the registry. We just designed the sequence.

Sequence: (Prefix and Suffix, 3A assembly scar, GroEL, RBS, Pribnow sequence, blue pigment)

5'

GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGAGatgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaTACTAGTAGCGGCCGCTGCAG

3'

Fig. 4: Our BioBrick as an important intermediate step


We thank our sponsors: