Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
| Line 4: | Line 4: | ||
<html> | <html> | ||
<h1>5/08/15</h1> | <h1>5/08/15</h1> | ||
| − | <br><h2> | + | <br><h2>Design primers</h2> |
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | ||
| Line 12: | Line 12: | ||
<br>TCCATACATTTTGATGGC -3’ | <br>TCCATACATTTTGATGGC -3’ | ||
<br> Primer Kan | <br> Primer Kan | ||
| + | <br> | ||
<br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | ||
| Line 26: | Line 27: | ||
<br>ACATTTTGATGGC-3’ | <br>ACATTTTGATGGC-3’ | ||
<br>Primer Kan | <br>Primer Kan | ||
| + | <br> | ||
<br>3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br> | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br> | ||
| Line 33: | Line 35: | ||
<br>GCATTC-5’ | <br>GCATTC-5’ | ||
<br>Primer Kan | <br>Primer Kan | ||
| + | <br> | ||
<br>5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br> | <br>5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br> | ||
| Line 42: | Line 45: | ||
| − | + | <br> | |
<br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br> | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.<br> | ||
<br>3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT | <br>3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT | ||
Revision as of 10:58, 14 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
Background
Aims
Results
Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.
5/08/15
Design primers
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
tail homologie PHO85
TCCATACATTTTGATGGC -3’
Primer Kan
3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
tail homologie PHO85
CGACCAGCATTC-5’
Primer Kan
5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
tail homologie PHO80
ACATTTTGATGGC-3’
Primer Kan
3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
tail homologie PHO80
GCATTC-5’
Primer Kan
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
tail homologie PHO85
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
FRT Primer Kan
3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
tail homologie PHO85
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
FRT Primer Kan
