Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 177: Line 177:
 
<li>Centrifuge for 30s at 13,000g and discard the supernatant.<br></li>
 
<li>Centrifuge for 30s at 13,000g and discard the supernatant.<br></li>
 
<li>Resuspend the cells in 1mL of sterile water and pipette 100µL samples into 1.5mL microcentrifuge tubes, one for each transformation.<br></li>
 
<li>Resuspend the cells in 1mL of sterile water and pipette 100µL samples into 1.5mL microcentrifuge tubes, one for each transformation.<br></li>
−
<li>Centrifuge at 13,000g for 30s and remove the supernatant.<br></li>
+
<li>For each transformation :<br></li>
−
<li>
+
<ul>
−
 
+
<li>240µL of PEG 3350 (50% (w/v))<br></li>
−
 
+
<li>36µL of LiAc 1.0M<br></li>
 +
<li>50µL of single-stranded carrier DNA (2.0mg.mL<sup>-1</sup>)<br></li>
 +
<li>6µL of PCR product <br></li>
 +
<li>28µL of water DNAse Free<br></li>
 +
</ul>
 
</html>
 
</html>
 
{{Paris_Bettencourt/footer}}
 
{{Paris_Bettencourt/footer}}

Revision as of 23:07, 14 August 2015

Background

Aims

Results

Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.

August 8th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’

- tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC-5’

- tail homology PHO80
- Primer Kanamycin

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- tail homology PHO85
- FRT
- Primer Kanamycin

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

13/08/15

PCR purification

Protocol :
  • Dilute PCR product (5 or 10 times ?) with the resuspension buffer
  • Pour it in a purification column
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Add 700µL of EtOH (washing solution)
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Add 500µLof washing solution
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Centrifuge 30sec at 14K rpm
  • Throw the filtrat
  • Put the column in a Eppendorf
  • Add 45µL of RNAse/DNAse free water right on the membrane
  • Wait 2min
  • Centrifuge 2min at 10K rpm

    • PCR The PCR control with an electrophoresis




    We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips wich have just the Kanamycin resistance with tails.

    Pre-culture

    Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let 's grow overnight.

    August 14th

    Transformation of yeast

    Protocol :
  • After growth, determine the titer of the yeast culture by using spectrophotometer : pipette 10µL of cells into 1mL of wtaer in spectrophotometer cuvette and measure the OD at 600nm.
  • Add 2.5x108 cells to 50mL of 2X YPD in a culture flask.
  • Incubate the flask in a shaking incubator at 30°C until the cell culture is at least 2x107 cells.mL-1
  • Denature 1mL of carrier DNA at 99°C for 5min and chill immediately in ice.
  • Harvest the yeast cells by centrifugation at 3,000g for 5min.
  • Resuspend the pellet in 25mL of sterile water and centrifuge at 3,000g for 5min at 20°C. Repeat this wash with sterile water 2 times.
  • Resuspend the last pellet in 1mL of sterile water.
  • Transfer the cell suspension to a 1.5mL microcentrifuge tube.
  • Centrifuge for 30s at 13,000g and discard the supernatant.
  • Resuspend the cells in 1mL of sterile water and pipette 100µL samples into 1.5mL microcentrifuge tubes, one for each transformation.
  • For each transformation :
    • 240µL of PEG 3350 (50% (w/v))
    • 36µL of LiAc 1.0M
    • 50µL of single-stranded carrier DNA (2.0mg.mL-1)
    • 6µL of PCR product
    • 28µL of water DNAse Free