Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Cloepierson (Talk | contribs) |
Cloepierson (Talk | contribs) |
||
| Line 38: | Line 38: | ||
<br> | <br> | ||
| − | <br><span style="color:#9A1717"> - | + | <br><span style="color:#9A1717"> - Homology tail on gene PHO80</span> |
| − | <br><span style="color:#179A89"> - | + | <br><span style="color:#179A89"> - Kanamycin resistance binding</span><br> |
<br><h3>Gene FRT + PHO85</h3> | <br><h3>Gene FRT + PHO85</h3> | ||
| Line 56: | Line 56: | ||
GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’ | GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’ | ||
<br> | <br> | ||
| − | <br><span style="color:#9A1717"> - | + | <br><span style="color:#9A1717"> - Homology tail on gene PHO85</span> |
| − | <br><span style="color:#36C40F"> - FRT</span> | + | <br><span style="color:#36C40F"> - FRT sequence</span> |
| − | <br><span style="color:#179A89"> - | + | <br><span style="color:#179A89"> - Kanamycin resistance binding</span><br> |
| Line 136: | Line 136: | ||
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/6/69/ParisBettencourt_Cycle_pcr_cassette_kanR.png" width="550px"> | <div class="column-right"><img src="https://static.igem.org/mediawiki/2015/6/69/ParisBettencourt_Cycle_pcr_cassette_kanR.png" width="550px"> | ||
| − | <p class="legend"><b>Figure 1:</b> PCR cycle</p></div> | + | <p class="legend"><b>Figure 1 :</b> PCR cycle</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 151: | Line 151: | ||
<div class="column-left"><img src="https://static.igem.org/mediawiki/2015/e/e0/ParisBettencourt_ElectrophoresisPCRKanResistance.png" width="350px"><br> | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/e/e0/ParisBettencourt_ElectrophoresisPCRKanResistance.png" width="350px"><br> | ||
| − | <p class="legend"><b>Figure 2:</b>Result of PCR</p></div> | + | <p class="legend"><b>Figure 2 :</b>Result of PCR</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 175: | Line 175: | ||
<div class="column-left"><img src="https://static.igem.org/mediawiki/2015/c/c7/Paris-bettencourt-controle884.png" width="300px"><br> | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/c/c7/Paris-bettencourt-controle884.png" width="300px"><br> | ||
| − | <p class="legend"><b>Figure 3:</b>Negative control</p> | + | <p class="legend"><b>Figure 3 :</b>Negative control</p> |
<img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"> | <img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"> | ||
| − | <p class="legend"><b>Figure 4:</b>Positive control and Result of transformation</p></div> | + | <p class="legend"><b>Figure 4 :</b>Positive control and Result of transformation</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 199: | Line 199: | ||
<br><h1>August 18th</h1> | <br><h1>August 18th</h1> | ||
| − | <h2>Verification of the new | + | <h2>Verification of the new negative control</h2> |
<div class="column-right">The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.</div><br> | <div class="column-right">The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.</div><br> | ||
| − | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/d/d8/Paris-bettencourt-g%C3%A9lose655584848.png" width="200px"><p class="legend"><b>Figure 5:</b>Result of the new negative control</p></div> | + | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/d/d8/Paris-bettencourt-g%C3%A9lose655584848.png" width="200px"><p class="legend"><b>Figure 5 :</b>Result of the new negative control</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| − | <h2> | + | <h2>FRT problems</h2> |
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for <i>E. coli</i>. We can't use this plasmid because it will be rejected by the yeast.<br> | The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for <i>E. coli</i>. We can't use this plasmid because it will be rejected by the yeast.<br> | ||
Other transformation with Cre lox system is possible.<br> | Other transformation with Cre lox system is possible.<br> | ||
| − | + | CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.<br><br> | |
| − | We create two primers for the new transformation with | + | We create two primers for the new transformation with CreLox system.<br><br> |
| − | Primer 5'-3' | + | Primer 5'-3' CreLox + PHO85<br> |
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">ATAACTTCGTATAGCATACATTATACGAAGTTAT</span><span style="color:#179A89">ATAATCATTTGCATCCATACATTTTGATGGC</span>-3’<br><br> | <br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">ATAACTTCGTATAGCATACATTATACGAAGTTAT</span><span style="color:#179A89">ATAATCATTTGCATCCATACATTTTGATGGC</span>-3’<br><br> | ||
| − | Primer 3'-5' | + | Primer 3'-5' CreLox + PHO85<br> |
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">ATAACTTCGTATAGCATACATTATACGAAGTTAT</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’<br> | <br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">ATAACTTCGTATAGCATACATTATACGAAGTTAT</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’<br> | ||
| − | <br><span style="color:#9A1717"> - tail | + | <br><span style="color:#9A1717"> - Homology tail on gene PHO85</span> |
| − | <br><span style="color:#36C40F"> - | + | <br><span style="color:#36C40F"> - CreLox sequence</span> |
| − | <br><span style="color:#179A89"> - | + | <br><span style="color:#179A89"> - Kanamycin resistance binding</span><br> |
<br><h1>August 19th</h1> | <br><h1>August 19th</h1> | ||
| Line 283: | Line 283: | ||
</table></div> | </table></div> | ||
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/c/cd/Paris-bettencourt-PCR5566565.png" width="550px"> | <div class="column-right"><img src="https://static.igem.org/mediawiki/2015/c/cd/Paris-bettencourt-PCR5566565.png" width="550px"> | ||
| − | <p class="legend"><b>Figure 6:</b> PCR | + | <p class="legend"><b>Figure 6 :</b> Colony PCR cycle</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 293: | Line 293: | ||
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/a/ab/Paris-bettencourt-electrophor%C3%A8se565.png" width="550px"> | <div class="column-right"><img src="https://static.igem.org/mediawiki/2015/a/ab/Paris-bettencourt-electrophor%C3%A8se565.png" width="550px"> | ||
| − | <p class="legend"><b>Figure 7:</b> Electrophoresis PCR colony</p></div> | + | <p class="legend"><b>Figure 7 :</b> Electrophoresis PCR colony</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
<br><h2>PCR of colony</h2> | <br><h2>PCR of colony</h2> | ||
| − | Same to August 19th | + | Same to August 19th. |
<br><h2>Electrophoresis control PCR</h2> | <br><h2>Electrophoresis control PCR</h2> | ||
| Line 305: | Line 305: | ||
| − | <div class="column-right"> The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can | + | <div class="column-right"> The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.</div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 321: | Line 321: | ||
| − | <div class="column-right"> The DNA Ladder is good but DNA of PCR did not migrate. The ADN | + | <div class="column-right"> The DNA Ladder is good but DNA of PCR products did not migrate. The ADN stay in the holes. We think that the yeasts walls being thicker, so a simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can fix.</div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
<br><h1>August 26th</h1> | <br><h1>August 26th</h1> | ||
<h2>Colony PCR</h2> | <h2>Colony PCR</h2> | ||
| − | To make the colony PCR, we need to lysis yeasts' wall. We realize the lysis with NaOH, but | + | To make the colony PCR, we need to lysis yeasts' wall. We realize the lysis with NaOH, but it did not work. |
So we realize a new lysis using the DNeasy Blood and Tissue kit with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.<br> | So we realize a new lysis using the DNeasy Blood and Tissue kit with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.<br> | ||
Revision as of 20:34, 26 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
August 8th
Design primers
Gene PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’
- Tail homology PHO85
- Primer Kanamycin
Gene PHO80
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’
- Homology tail on gene PHO80
- Kanamycin resistance binding
Gene FRT + PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding
August 12nd
Culture
Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.
PCR
3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.
Protocol:
PHO80 PHO85 FRT+ PHO85 Master mix (µL) 50 50 50 H2O DNAse Free (µL) 45 45 45 Resistance plasmid (µL) 1 1 1 PHO80 5'Primer (µL) 2 PHO80 3'Primer (µL) 2 PHO85 5'Primer (µL) 2 PHO85 3'Primer (µL) 2 PHO85 + FRT 5'Primer (µL) 2 PHO85 + FRT 3'Primer (µL) 2 
Figure 1 : PCR cycle
August 13rd
PCR Purification
Protocol : PCR purification
PCR control with an electrophoresis
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.
Figure 2 :Result of PCR
Pre-culture
Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.
August 14th
Transformation of yeast
Protocol: Heat shock transformation for yeastAugust 17th
Result of plates:
There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.
We look only few colonies in the plates with yeast transforming PHO80.
The result is well, transformation works.
Figure 3 :Negative control
Figure 4 :Positive control and Result of transformation
Verification of the results
Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG
August 18th
Verification of the new negative control
The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.
Figure 5 :Result of the new negative control
FRT problems
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with Cre lox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.
We create two primers for the new transformation with CreLox system.
Primer 5'-3' CreLox + PHO85
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’
Primer 3'-5' CreLox + PHO85
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’
- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding
August 19th
PCR sur colony
Protocol:
PHO80 PHO85 FRT+ PHO85 dreamTaq 2X (µL) 3 3 3 H2O DNAse Free (µL) 9 9 9 Colony 1 1 1 PHO80 5'Primer (µL) 0.5 PHO80 3'Primer (µL) 0.5 PHO85 5'Primer (µL) 0.5 0.5 PHO85 3'Primer (µL) 0.5 0.5 
Figure 6 : Colony PCR cycle
August 20th
Electrophoresis control PCR
We only see bands smaller than 500bp, but not the fragments we expected. We start again the same PCR colony.
Figure 7 : Electrophoresis PCR colony
PCR of colony
Same to August 19th.Electrophoresis control PCR
Figure 8 : second electrophoresis PCR colony
The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.August 24th
Yeast lysis with NaOH
Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.
August 25th
PCR Verification
Electrophoresis control PCR
Figure 8 : second electrophoresis PCR colony
The DNA Ladder is good but DNA of PCR products did not migrate. The ADN stay in the holes. We think that the yeasts walls being thicker, so a simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can fix.August 26th
Colony PCR
To make the colony PCR, we need to lysis yeasts' wall. We realize the lysis with NaOH, but it did not work. So we realize a new lysis using the DNeasy Blood and Tissue kit with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.
Phytic acid dosage
We dose the phytic acid in the idli with the kit "Phytic Acid (Total Phosphorus) Assay Kit".
