Difference between revisions of "Team:Hamburg/Composite Part"

Line 5: Line 5:
  
 
<h2> Composite Parts</h2>
 
<h2> Composite Parts</h2>
 +
 +
<h3>constitutive promoter and miRNA</h3>
 +
 +
<p>Following our <a href="https://2015.igem.org/Team:Hamburg/Parts">ultimate goal</a> of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as important intermediate step. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860700">miRNA2911</a> and a standard promotor (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a>).</p>
 +
 +
<p><b>BioBrick state: </b>We submitted the <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860702">constitutive promoter and miRNA2911</a> biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR.</p>
 +
 +
<p><b>Sequence:</b> (<font color="orange">Prefix and Suffix</font>, <font color="red">3A assembly scar</font>, <font color="cyan">promoter</font>, miRNA)</p>
 +
<p>5'</p>
 +
<p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font><font color="cyan">ttgacggctagctcagtcctaggtacagtgctagc</font><font color="red">TACTAGAG</font>GGCCGGGGGACGGACTGGGA<font color="orange">TACTAGTAGCGGCCGCTGCAG</font></FONT></p>
 +
<p>3'</p>
  
 
<style>
 
<style>

Revision as of 17:02, 18 September 2015

Composite Parts

constitutive promoter and miRNA

Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as important intermediate step. It is a composite part of our basic part miRNA2911 and a standard promotor (BBa_J23100).

BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR.

Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)

5'

GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG

3'

Fig. 1: Future BioBrick regarding our ultimate goal
Fig. 2: Our BioBrick as intermediate step

Note

In order to be considered for the Best New Composite Part award, you must fill out this page. Please give links to the Registry entries for the Composite parts you have made. Please see the Registry's Help:Parts page for more information on part types.

A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. BBa_I13507 is an example of a composite part, consisting of an RBS, a protein coding region for a red fluorescent protein, and a terminator.

New composite BioBrick devices can be made by combining existing BioBrick Parts (like Inverters, Amplifiers, Smell Generators, Protein Balloon Generators, Senders, Receivers, Actuators, and so on).


We thank our sponsors: