Difference between revisions of "Team:Hamburg/Composite Part"

Line 34: Line 34:
  
 
<h3>GroEL promoter and blue Pigment</h3>
 
<h3>GroEL promoter and blue Pigment</h3>
<p>Also for establishing a heat-inducible cell lysis system (GroEL and PezT) we started to create a intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860701">GroEL</a> and a blue pigment (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K592009">BBa_J23100</a>). Future work would target a BioBrick of GroEL and PezT.</p>
+
<p>Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create a intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860701">GroEL</a> and a blue pigment (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K592009">BBa_J23100</a>) (figure 4). Future work would target a BioBrick of GroEL and PezT.</p>
  
 
<a href=""></a>
 
<a href=""></a>
Line 40: Line 40:
 
   <figure class="fig1">
 
   <figure class="fig1">
 
     <img src="https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg"/>
 
     <img src="https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg"/>
     <figcaption></figcaption>
+
     <figcaption>Fig. 3: Future BioBrick regarding our ultimate goal</figcaption>
 
   </figure>
 
   </figure>
  
Line 55: Line 55:
 
   <figure class="fig1">
 
   <figure class="fig1">
 
     <img src="https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg"/>
 
     <img src="https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg"/>
     <figcaption></figcaption>
+
     <figcaption>Fig. 4: Our BioBrick as an important intermediate step</figcaption>
 
   </figure>
 
   </figure>
 
<div class="highlightBox">
 
<h4>Note</h4>
 
<p>In order to be considered for the <a href="https://2015.igem.org/Judging/Awards#SpecialPrizes">Best New Composite Part award</a>, you must fill out this page. Please give links to the Registry entries for the Composite parts you have made. Please see the Registry's <a href="http://parts.igem.org/Help:Parts#Basic_and_Composite_Parts"> Help:Parts page</a> for more information on part types.</p>
 
</div>
 
 
<p>
 
A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. <a href="http://parts.igem.org/wiki/index.php/Part:BBa_I13507">BBa_I13507</a> is an example of a composite part, consisting of an RBS, a protein coding region for a red fluorescent protein, and a terminator.
 
</p>
 
 
<p>New composite BioBrick devices can be made by combining existing BioBrick Parts (like Inverters, Amplifiers, Smell Generators, Protein Balloon Generators, Senders, Receivers, Actuators, and so on).</p>
 
  
  

Revision as of 18:00, 18 September 2015

Composite Parts

constitutive promoter and miRNA

Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as important intermediate step. It is a composite part of our basic part miRNA2911 and the standard promotor BBa_J23100 (figure 2).

Fig. 1: Future BioBrick regarding our ultimate goal

BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.

Fig. 2: Our BioBrick as an important intermediate step

Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)

5'

GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG

3'

GroEL promoter and blue Pigment

Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create a intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part GroEL and a blue pigment (BBa_J23100) (figure 4). Future work would target a BioBrick of GroEL and PezT.

Fig. 3: Future BioBrick regarding our ultimate goal

BioBrick state: We did not submit the GroEL and blue pigment biobrick to the registry. We just designed the sequence.

Sequence: (Prefix and Suffix, 3A assembly scar, GroEL, RBS, Pribnow sequence, blue pigment)

5'

GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGAGatgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaTACTAGTAGCGGCCGCTGCAG

3'

Fig. 4: Our BioBrick as an important intermediate step


We thank our sponsors: