Difference between revisions of "Team:Hamburg/Composite Part"
Glykokalyx (Talk | contribs) |
|||
(15 intermediate revisions by one other user not shown) | |||
Line 5: | Line 5: | ||
<h2> Composite Parts</h2> | <h2> Composite Parts</h2> | ||
+ | |||
+ | <h3>constitutive promoter and miRNA</h3> | ||
+ | |||
+ | <p>Following our <a href="https://2015.igem.org/Team:Hamburg/Parts">ultimate goal</a> of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as an important intermediate step. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860700">miRNA2911</a> and the standard promotor <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a> (figure 2).</p> | ||
<style> | <style> | ||
Line 10: | Line 14: | ||
width: 35%;} | width: 35%;} | ||
</style> | </style> | ||
+ | |||
<figure class="fig1"> | <figure class="fig1"> | ||
− | <img src="https://static.igem.org/mediawiki/2015/ | + | <img src="https://static.igem.org/mediawiki/2015/b/b2/Hamburg_parts6.jpg"/> |
− | <figcaption> | + | <figcaption>Fig. 1: Future BioBrick regarding our ultimate goal</figcaption> |
</figure> | </figure> | ||
+ | <p><b>BioBrick state: </b>We submitted the <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860702">constitutive promoter and miRNA2911</a> biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.</p> | ||
<figure class="fig1"> | <figure class="fig1"> | ||
− | <img src="https://static.igem.org/mediawiki/2015/ | + | <img src="https://static.igem.org/mediawiki/2015/d/d2/Hamburg_parts5.jpg"/> |
− | <figcaption> | + | <figcaption>Fig. 2: Our BioBrick as an important intermediate step</figcaption> |
</figure> | </figure> | ||
+ | |||
+ | <p><b>Sequence:</b> (<font color="orange">Prefix and Suffix</font>, <font color="red">3A assembly scar</font>, <font color="cyan">promoter</font>, miRNA)</p> | ||
+ | <p>5'</p> | ||
+ | <p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font><font color="cyan">ttgacggctagctcagtcctaggtacagtgctagc</font><font color="red">TACTAGAG</font>GGCCGGGGGACGGACTGGGA<font color="orange">TACTAGTAGCGGCCGCTGCAG</font></FONT></p> | ||
+ | <p>3'</p> | ||
+ | |||
+ | <h3>GroEL promoter and blue Pigment</h3> | ||
+ | <p>Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create an intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860701">GroEL</a> and a blue pigment (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K592009">BBa_J23100</a>) (figure 4). Future work would target a BioBrick of GroEL and PezT.</p> | ||
+ | |||
+ | <a href=""></a> | ||
<figure class="fig1"> | <figure class="fig1"> | ||
<img src="https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg"/> | <img src="https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg"/> | ||
− | <figcaption></figcaption> | + | <figcaption>Fig. 3: Future BioBrick regarding our ultimate goal</figcaption> |
</figure> | </figure> | ||
+ | <p><b>BioBrick state: </b>We did <i>not</i> submit the <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860703">GroEL and blue pigment</a> biobrick to the registry. We just designed the sequence.</p> | ||
− | + | <p><b>Sequence:</b> (<font color="orange">Prefix and Suffix</font>, <font color="red">3A assembly scar</font>, GroEL, <font color="green">RBS</font>, <font color="blue">Pribnow sequence</font>, <font color="cyan">blue pigment</font>)</p> | |
− | + | ||
− | + | ||
− | + | ||
− | < | + | <p>5'</p> |
− | < | + | <p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font>CAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTT<font color="green">GAAGGAG</font><font color="blue">ATATTA</font><font color="red">TACTAGAG</font><font color="cyan">atgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa</font><font color="orange">TACTAGTAGCGGCCGCTGCAG</font></FONT></p> |
− | < | + | <p>3'</p> |
− | </ | + | |
− | |||
− | |||
− | |||
− | < | + | |
+ | <figure class="fig1"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg"/> | ||
+ | <figcaption>Fig. 4: Our BioBrick as an important intermediate step</figcaption> | ||
+ | </figure> | ||
Latest revision as of 23:33, 18 September 2015
Composite Parts
constitutive promoter and miRNA
Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as an important intermediate step. It is a composite part of our basic part miRNA2911 and the standard promotor BBa_J23100 (figure 2).
![](https://static.igem.org/mediawiki/2015/b/b2/Hamburg_parts6.jpg)
BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.
![](https://static.igem.org/mediawiki/2015/d/d2/Hamburg_parts5.jpg)
Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)
5'
GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG
3'
GroEL promoter and blue Pigment
Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create an intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part GroEL and a blue pigment (BBa_J23100) (figure 4). Future work would target a BioBrick of GroEL and PezT.
![](https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg)
BioBrick state: We did not submit the GroEL and blue pigment biobrick to the registry. We just designed the sequence.
Sequence: (Prefix and Suffix, 3A assembly scar, GroEL, RBS, Pribnow sequence, blue pigment)
5'
GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGAGatgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaTACTAGTAGCGGCCGCTGCAG
3'
![](https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg)