Difference between revisions of "Team:Hamburg/Composite Part"
Glykokalyx (Talk | contribs) |
|||
(2 intermediate revisions by one other user not shown) | |||
Line 8: | Line 8: | ||
<h3>constitutive promoter and miRNA</h3> | <h3>constitutive promoter and miRNA</h3> | ||
− | <p>Following our <a href="https://2015.igem.org/Team:Hamburg/Parts">ultimate goal</a> of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as important intermediate step. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860700">miRNA2911</a> and the standard promotor <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a> (figure 2).</p> | + | <p>Following our <a href="https://2015.igem.org/Team:Hamburg/Parts">ultimate goal</a> of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as an important intermediate step. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860700">miRNA2911</a> and the standard promotor <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a> (figure 2).</p> |
<style> | <style> | ||
Line 34: | Line 34: | ||
<h3>GroEL promoter and blue Pigment</h3> | <h3>GroEL promoter and blue Pigment</h3> | ||
− | <p>Also for establishing a heat-inducible cell lysis system (GroEL and PezT) we started to create | + | <p>Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create an intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1860701">GroEL</a> and a blue pigment (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K592009">BBa_J23100</a>) (figure 4). Future work would target a BioBrick of GroEL and PezT.</p> |
<a href=""></a> | <a href=""></a> | ||
Line 40: | Line 40: | ||
<figure class="fig1"> | <figure class="fig1"> | ||
<img src="https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg"/> | <img src="https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg"/> | ||
− | <figcaption></figcaption> | + | <figcaption>Fig. 3: Future BioBrick regarding our ultimate goal</figcaption> |
</figure> | </figure> | ||
Line 48: | Line 48: | ||
<p>5'</p> | <p>5'</p> | ||
− | <p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font>CAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTT<font color="green">GAAGGAG</font><font color="blue">ATATTA</font><font color="red">TACTAGAG</font><font color="cyan">atgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac | + | <p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font>CAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTT<font color="green">GAAGGAG</font><font color="blue">ATATTA</font><font color="red">TACTAGAG</font><font color="cyan">atgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa</font><font color="orange">TACTAGTAGCGGCCGCTGCAG</font></FONT></p> |
<p>3'</p> | <p>3'</p> | ||
Line 55: | Line 55: | ||
<figure class="fig1"> | <figure class="fig1"> | ||
<img src="https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg"/> | <img src="https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg"/> | ||
− | <figcaption></figcaption> | + | <figcaption>Fig. 4: Our BioBrick as an important intermediate step</figcaption> |
</figure> | </figure> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
Latest revision as of 23:33, 18 September 2015
Composite Parts
constitutive promoter and miRNA
Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as an important intermediate step. It is a composite part of our basic part miRNA2911 and the standard promotor BBa_J23100 (figure 2).
![](https://static.igem.org/mediawiki/2015/b/b2/Hamburg_parts6.jpg)
BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.
![](https://static.igem.org/mediawiki/2015/d/d2/Hamburg_parts5.jpg)
Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)
5'
GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG
3'
GroEL promoter and blue Pigment
Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create an intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part GroEL and a blue pigment (BBa_J23100) (figure 4). Future work would target a BioBrick of GroEL and PezT.
![](https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg)
BioBrick state: We did not submit the GroEL and blue pigment biobrick to the registry. We just designed the sequence.
Sequence: (Prefix and Suffix, 3A assembly scar, GroEL, RBS, Pribnow sequence, blue pigment)
5'
GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGAGatgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaTACTAGTAGCGGCCGCTGCAG
3'
![](https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg)