Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Line 7: | Line 7: | ||
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | ||
− | <br>5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA | + | <br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA |
<br> tail homologie PHO85 | <br> tail homologie PHO85 | ||
Revision as of 13:57, 14 August 2015