Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
| Line 7: | Line 7: | ||
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | ||
| − | <br>5’-<span style="color:#9A1717"> | + | <br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG<span style="color:#179A89>ATAATCATTTGCA |
| − | <br> tail homologie PHO85 | + | <br> tail <span style="color:#9A1717">homologie PHO85 |
| − | <br>TCCATACATTTTGATGGC -3’ | + | <br><span style="color:#179A89>TCCATACATTTTGATGGC -3’ |
<br> Primer Kan | <br> Primer Kan | ||
<br> | <br> | ||
Revision as of 13:59, 14 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
Background
Aims
Results
Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.
