Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 5: Line 5:
 
<h1>5/08/15</h1>
 
<h1>5/08/15</h1>
 
<br><h2>Design primers</h2>
 
<br><h2>Design primers</h2>
 +
<br><h3>gene PHO85</h3>
  
 
5’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br>
 
5’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br>
−
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG<span style="color:#179A89>ATAATCATTTGCA
+
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#179A89">ATAATCATTTGCA
−
<br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;tail <span style="color:#9A1717">homologie PHO85
+
  
−
<br><span style="color:#179A89>TCCATACATTTTGATGGC -3’
+
<br>TCCATACATTTTGATGGC </span>-3’
−
<br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Primer Kan
+
 
<br>
 
<br>
  
 
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br>
 
<br>3’Primer  of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br>
−
<br>3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
+
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#179A89">CAGCAGTATAG
−
<br>tail homologie PHO85
+
 
 +
<br>CGACCAGCATTC</span>-5’
 +
<br>
 +
 
 +
<br><span style="color:#9A1717"> -&nbsp;tail homologie PHO85 </span>
 +
<br><span style="color:#179A89"> -&nbsp;Primer Kan
  
−
<br>CGACCAGCATTC-5’
 
−
<br>Primer Kan
 
  
 
<br>5’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br>
 
<br>5’Primer  of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.<br>

Revision as of 15:00, 14 August 2015

Background

Aims

Results

Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.

5/08/15


Design primers


gene PHO85

5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’

3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’

- tail homologie PHO85
- Primer Kan
5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.

5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
tail homologie PHO80
ACATTTTGATGGC-3’
Primer Kan

3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.

3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
tail homologie PHO80
GCATTC-5’
Primer Kan

5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
tail homologie PHO85
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
FRT Primer Kan

3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
tail homologie PHO85
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
FRT Primer Kan