Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
| Line 7: | Line 7: | ||
<br><h3>Gene PHO85</h3> | <br><h3>Gene PHO85</h3> | ||
| − | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast. | + | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast. |
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#179A89">ATAATCATTTGCA | <br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#179A89">ATAATCATTTGCA | ||
| Line 13: | Line 13: | ||
<br> | <br> | ||
| − | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast. | + | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast. |
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#179A89">CAGCAGTATAG | <br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#179A89">CAGCAGTATAG | ||
| Line 24: | Line 24: | ||
<br><h3>Gene PHO80</h3> | <br><h3>Gene PHO80</h3> | ||
| − | <br>5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. | + | <br>5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. |
<br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT | <br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT | ||
| Line 31: | Line 31: | ||
| − | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. | + | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. |
<br>3’-<span style="color:#9A1717">CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCA</span><span style="color:#179A89">CAGCAGTATAGCGACCA | <br>3’-<span style="color:#9A1717">CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCA</span><span style="color:#179A89">CAGCAGTATAGCGACCA | ||
| Line 43: | Line 43: | ||
<br><h3>Gene FRT + PHO85</h3> | <br><h3>Gene FRT + PHO85</h3> | ||
| − | <br>5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. | + | <br>5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. |
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC | <br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC | ||
| Line 50: | Line 50: | ||
<br> | <br> | ||
| − | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. | + | <br>3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. |
<br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">CTTCAAGGATAT | <br>3’-<span style="color:#9A1717">AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA</span><span style="color:#36C40F">CTTCAAGGATAT | ||
<br>GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’ | <br>GAAAGATCTCTTATCCTTGAAG</span><span style="color:#179A89">CAGCAGTATAGCGACCAGCATTC</span>-5’ | ||
| − | + | <br> | |
| + | <br><span style="color:#9A1717"> - tail homologie PHO85 </span> | ||
| + | <br><span style="color:#36C40F"> - FRT</span> | ||
| + | <br><span style="color:#179A89"> - Primer Kan </span> | ||
Revision as of 15:17, 14 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
Background
Aims
Results
Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.
5/08/15
Design primers
Gene PHO85
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’
3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’
- tail homologie PHO85
- Primer KanGene PHO80
5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC-3’
3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC-5’
- tail homologie PHO80
- Primer KanGene FRT + PHO85
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- tail homologie PHO85
- FRT
- Primer Kan
