Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 3: Line 3:
 
{{Paris_Bettencourt/phytaseBanner}}
 
{{Paris_Bettencourt/phytaseBanner}}
 
<html>
 
<html>
−
<h1>August 8th</h1>
+
 
 +
<div id="notebookMenu">
 +
  <ul>
 +
    <li><a href="#august">August</a></li>
 +
    <li><a href="#september">September</a></li>
 +
  </ul>
 +
</div>
 +
 
 +
<div id="notebookContent">
 +
<a name="august" class="anchor"><h1></h1></a>
 +
<h1 class="date">August 8th</h1>
 
<h2>Design primers</h2>
 
<h2>Design primers</h2>
 
<h3>Gene PHO85</h3>
 
<h3>Gene PHO85</h3>
Line 61: Line 71:
  
  
−
<br><h1>August 12nd</h1>
+
<br><h1 class="date">August 12nd</h1>
 
<h2>Culture</h2>
 
<h2>Culture</h2>
 
Inoculate 100µL of <i>Saccharomyces cerevisiae SK1</i> on YPD medium overnight (at 30°C).  
 
Inoculate 100µL of <i>Saccharomyces cerevisiae SK1</i> on YPD medium overnight (at 30°C).  
Line 139: Line 149:
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
  
−
<br><h1>August 13rd</h1>
+
<br><h1 class="date">August 13th</h1>
 
<h2>PCR Purification</h2>
 
<h2>PCR Purification</h2>
 
Protocol :
 
Protocol :
Line 157: Line 167:
 
Swo one colony of <i>Saccharomyces cerevisiae SK1</i> in 5mL liquid YPD medium and let's grow overnight.<br>
 
Swo one colony of <i>Saccharomyces cerevisiae SK1</i> in 5mL liquid YPD medium and let's grow overnight.<br>
  
−
<br><h1>August 14th</h1>
+
<br><h1 class="date">August 14th</h1>
 
Transformation of yeast<br>
 
Transformation of yeast<br>
 
Protocol:
 
Protocol:
Line 198: Line 208:
 
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br>
 
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br>
 
   
 
   
−
<br><h1>August 18th</h1>
+
<br><h1 class="date">August 18th</h1>
 
<h2>Verification of the new negative control</h2>
 
<h2>Verification of the new negative control</h2>
 
<div class="column-right">The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.</div><br>
 
<div class="column-right">The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.</div><br>
Line 225: Line 235:
 
<br><span style="color:#179A89"> -&nbsp;Kanamycin resistance binding</span><br>
 
<br><span style="color:#179A89"> -&nbsp;Kanamycin resistance binding</span><br>
  
−
<br><h1>August 19th</h1>
+
<br><h1 class="date">August 19th</h1>
  
 
<h2>PCR sur colony</h2>
 
<h2>PCR sur colony</h2>
Line 286: Line 296:
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
  
−
<br><h1>August 20th</h1>
+
<br><h1 class="date">August 20th</h1>
  
 
<h2>Electrophoresis control PCR</h2>
 
<h2>Electrophoresis control PCR</h2>
Line 313: Line 323:
 
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd. <br>
 
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd. <br>
  
−
<br><h1>August 25th</h1>
+
<br><h1 class="date">August 25th</h1>
 
<h2>PCR Verification</h2>  
 
<h2>PCR Verification</h2>  
 
<h2>Electrophoresis control PCR</h2>
 
<h2>Electrophoresis control PCR</h2>
Line 327: Line 337:
  
  
−
<br><h1>August 26th</h1>
+
<br><h1 class="date">August 26th</h1>
 
<h2>Colony PCR</h2>  
 
<h2>Colony PCR</h2>  
 
To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work.
 
To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work.
Line 337: Line 347:
  
  
−
<br><h1>August 27th</h1>
+
<br><h1 class="date">August 27th</h1>
 
<h2>Electrophoresis control PCR</h2>
 
<h2>Electrophoresis control PCR</h2>
 
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/c/ce/ParisBettencourt_PCR_colony_gradient_27.08.png" width="550px">
 
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/c/ce/ParisBettencourt_PCR_colony_gradient_27.08.png" width="550px">
Line 353: Line 363:
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
  
 +
</div>
  
 
</html>
 
</html>
 
{{Paris_Bettencourt/footer}}
 
{{Paris_Bettencourt/footer}}

Revision as of 10:49, 28 August 2015

August 8th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’

- Tail homology PHO85
- Primer Kanamycin

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’

- Homology tail on gene PHO80
- Kanamycin resistance binding

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

Figure 1 : PCR cycle


August 13th

PCR Purification

Protocol : PCR purification

PCR control with an electrophoresis



We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.

Figure 2 :Result of PCR


Pre-culture

Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

August 14th

Transformation of yeast
Protocol: Heat shock transformation for yeast

August 17th

Result of plates:

There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.

We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.






The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.

We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.

We look only few colonies in the plates with yeast transforming PHO80.

The result is well, transformation works.

Figure 3 :Negative control

Figure 4 :Positive control and Result of transformation

Verification of the results

Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG

August 18th

Verification of the new negative control

The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.

Figure 5 :Result of the new negative control

FRT problems

The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with Cre lox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.

We create two primers for the new transformation with CreLox system.

Primer 5'-3' CreLox + PHO85

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’

Primer 3'-5' CreLox + PHO85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding

August 19th

PCR sur colony

Protocol:
PHO80 PHO85 FRT+ PHO85
dreamTaq 2X (µL) 3 3 3
H2O DNAse Free (µL) 9 9 9
Colony 1 1 1
PHO80 5'Primer (µL) 0.5
PHO80 3'Primer (µL) 0.5
PHO85 5'Primer (µL) 0.5 0.5
PHO85 3'Primer (µL) 0.5 0.5

Figure 6 : Colony PCR cycle


August 20th

Electrophoresis control PCR



We only see bands smaller than 500bp, but not the fragments we expected. We start again the same PCR colony.

Figure 7 : Electrophoresis PCR colony


PCR of colony

Same to August 19th.

Electrophoresis control PCR

Figure 8 : second electrophoresis PCR colony

The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.

August 24th


Yeast lysis with NaOH

Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.

August 25th

PCR Verification

Electrophoresis control PCR

Figure 9 : Third electrophoresis PCR colony

The DNA ladder migrate, but there was any amplification of the both genes.
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of OH plasmid and the oligos using for PHO85 gene.

August 26th

Colony PCR

To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work. So we realize a new lysis using the DNeasy Blood and Tissue kit with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.

Phytic acid dosage

We dose the phytic acid in the idli with the kit "Phytic Acid (Total Phosphorus) Assay Kit".

August 27th

Electrophoresis control PCR

Figure 10 : Electrophoresis PCR colony with temperature gradient

Phytic acid dosage

We dose the phytic acid in the idli fermented with different strains.

Second electrophoresis control PCR

Figure 11 : Second electrophoresis PCR colony with temperature gradient

We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.
We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.