Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
| Line 208: | Line 208: | ||
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br> | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br> | ||
| + | |||
| + | |||
| + | |||
<br><h1 class="date one">August 18th</h1> | <br><h1 class="date one">August 18th</h1> | ||
<h2>Verification of the new negative control</h2> | <h2>Verification of the new negative control</h2> | ||
| Line 234: | Line 237: | ||
<br><span style="color:#36C40F"> - CreLox sequence</span> | <br><span style="color:#36C40F"> - CreLox sequence</span> | ||
<br><span style="color:#179A89"> - Kanamycin resistance binding</span><br> | <br><span style="color:#179A89"> - Kanamycin resistance binding</span><br> | ||
| + | |||
| + | |||
| + | |||
| + | |||
<br><h1 class="date one">August 19th</h1> | <br><h1 class="date one">August 19th</h1> | ||
| Line 299: | Line 306: | ||
<h2>Electrophoresis control PCR</h2> | <h2>Electrophoresis control PCR</h2> | ||
| − | <div class="column-left"><br><br>We only see bands smaller than 500bp, but not the fragments we expected. We start again the same PCR colony.</div> | + | <div class="column-left"><br><br>We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony.</div> |
| Line 318: | Line 325: | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| − | <br><h1>August 24th</h1> | + | <br><h1 class="date one">August 24th</h1> |
<br><h2>Yeast lysis with NaOH</h2> | <br><h2>Yeast lysis with NaOH</h2> | ||
<b>Protocol:</b> <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Yeast_lysis_with_NaOH"> Yeast lysis with NaOH</a><br> | <b>Protocol:</b> <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Yeast_lysis_with_NaOH"> Yeast lysis with NaOH</a><br> | ||
| Line 328: | Line 335: | ||
<div class="column-left"><img src="https://static.igem.org/mediawiki/2015/0/06/ParisBettencourt_PCR_colony_25.08.png" width="550px"> | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/0/06/ParisBettencourt_PCR_colony_25.08.png" width="550px"> | ||
| − | <p class="legend"><b>Figure 9 :</b> Third electrophoresis PCR colony</p></div> | + | <p class="legend"><b>Figure 9 :</b> Third electrophoresis PCR colony with NaOH lysis</p></div> |
| Line 343: | Line 350: | ||
<h2>Phytic acid dosage</h2> | <h2>Phytic acid dosage</h2> | ||
| − | We dose the phytic acid in the | + | We dose the phytic acid in the fermented rice with the kit "Phytic Acid (Total Phosphorus) Assay Kit". |
| Line 350: | Line 357: | ||
<h2>Electrophoresis control PCR</h2> | <h2>Electrophoresis control PCR</h2> | ||
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/c/ce/ParisBettencourt_PCR_colony_gradient_27.08.png" width="550px"> | <div class="column-right"><img src="https://static.igem.org/mediawiki/2015/c/ce/ParisBettencourt_PCR_colony_gradient_27.08.png" width="550px"> | ||
| − | <p class="legend"><b>Figure 10 :</b> Electrophoresis | + | <p class="legend"><b>Figure 10 :</b> Electrophoresis colony PCR with temperature gradient on non-transformed yeasts lysed by the zymolyase</p></div> |
| − | <div class="column-left"> | + | <div class="column-left">We made a PCR gradient to know exactly wich temperature is better to a good fixation of the primers on the DNA. The amplification failed, we supposed it is because our MasterMix did not work.</div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
Revision as of 13:17, 28 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
Vitamin A Vitamin B2 Vitamin B12 Phytase Riboswitch Differentiation on E. coli Differentiation on S. cerevisiae Manufacturing Idli and Micro-organisms August 8th
Design primers
Gene PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’
- Tail homology PHO85
- Primer Kanamycin
Gene PHO80
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’
- Homology tail on gene PHO80
- Kanamycin resistance binding
Gene FRT + PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding
August 12nd
Culture
Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.
PCR
3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.
Protocol:
PHO80 PHO85 FRT+ PHO85 Master mix (µL) 50 50 50 H2O DNAse Free (µL) 45 45 45 Resistance plasmid (µL) 1 1 1 PHO80 5'Primer (µL) 2 PHO80 3'Primer (µL) 2 PHO85 5'Primer (µL) 2 PHO85 3'Primer (µL) 2 PHO85 + FRT 5'Primer (µL) 2 PHO85 + FRT 3'Primer (µL) 2 
Figure 1 : PCR cycle
August 13th
PCR Purification
Protocol : PCR purification
PCR control with an electrophoresis
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.
Figure 2 :Result of PCR
Pre-culture
Plated one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.
August 14th
Transformation of yeast
Protocol: Heat shock transformation for yeastAugust 17th
Result of plates:
There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.
We look only few colonies in the plates with yeast transforming PHO80.
The result is well, transformation works.
Figure 3 :Negative control
Figure 4 :Positive control and Result of transformation
Verification of the results
Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG
August 18th
Verification of the new negative control
The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.
Figure 5 :Result of the new negative control
FRT problems
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with Cre lox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.
We create two primers for the new transformation with CreLox system.
Primer 5'-3' CreLox + PHO85
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’
Primer 3'-5' CreLox + PHO85
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’
- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding
August 19th
PCR sur colony
Protocol:
PHO80 PHO85 FRT+ PHO85 dreamTaq 2X (µL) 3 3 3 H2O DNAse Free (µL) 9 9 9 Colony 1 1 1 PHO80 5'Primer (µL) 0.5 PHO80 3'Primer (µL) 0.5 PHO85 5'Primer (µL) 0.5 0.5 PHO85 3'Primer (µL) 0.5 0.5 
Figure 6 : Colony PCR cycle
August 20th
Electrophoresis control PCR
We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony.
Figure 7 : Electrophoresis PCR colony
PCR of colony
Same to August 19th.Electrophoresis control PCR
Figure 8 : second electrophoresis PCR colony
The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.August 24th
Yeast lysis with NaOH
Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.
August 25th
PCR Verification
Electrophoresis control PCR
Figure 9 : Third electrophoresis PCR colony with NaOH lysis
The DNA ladder migrate, but there was any amplification of the both genes.
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of OH plasmid and the oligos using for PHO85 gene.August 26th
Colony PCR
To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work. So we realize a new lysis using the DNeasy Blood and Tissue kit with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.
Phytic acid dosage
We dose the phytic acid in the fermented rice with the kit "Phytic Acid (Total Phosphorus) Assay Kit".August 27th
Electrophoresis control PCR
Figure 10 : Electrophoresis colony PCR with temperature gradient on non-transformed yeasts lysed by the zymolyase
We made a PCR gradient to know exactly wich temperature is better to a good fixation of the primers on the DNA. The amplification failed, we supposed it is because our MasterMix did not work.Phytic acid dosage
We dose the phytic acid in fermented rice.
Figure 12 : Acid phytic dosage on fermented rice
Second electrophoresis control PCR
Figure 11 : Second electrophoresis PCR colony with temperature gradient
We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.
We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.August 28th
Phytic acid dosage in different strains
Figure 13 : Acid phytic dosage on fermented rice with some strains
Figure 14 : Results of acid phytic dosage on fermented rice
