In order to gain trust from the population, the technology should belong to everyone. In a way similar to the open-source software industry, people should be able to improve our project or create their own versions of it. This idea of openness is very common among the community of synthetic biologists, but a lot of pitfalls have to be overcome to make it a sustainable reality.

A parallel could be drawn with electronics in the 1960's, when computer programming was extremely low-level and belonged to the realm of academia. Since then, it has reached a way wider population, thanks to the creation of frameworks allowing for abstraction of the most technical parts. How could the same principles be applied to synthetic biology, in the context of metabolic engineering and vitamins production?

Even though a lot of lab strains designed for easier modification have been designed in the past, they usually have a very general purpose and biotechnology remains a matter of specialists where every modification has to be made from scratch. We imagined a repurposed organism made especially for the quick construction of these self-replicative tiny factories, that could be easily used by startups, community labs or just by enthusiasts. In the following section we discuss the constraints associated with it, and what such an organism could look like.

For a biological product to leave the benches and actually reach the population, it's essential to foresee its life in the hands of the people who will cultivate it and make sure it stays alive all along. Our design must therefore provide strategies to create an durable, usable product. On paper, the plan is simple: the manufacturers grow the micro-organism, distribute it and save a little fraction to start a new culture with. This could in principle last forever, but in reality the universal rules of biology soon kick back in.

Let's consider the following scenario: a wild type organism sneaks into the incubator and starts to replicate along with the engineered organism. Our microbe cannot compete: this contaminant has been selected precisely for its ability to sneak into environments and replicate, during hundreds of years, while our microbe has the burden of producing tons of enzymes to make the precious vitamins. Additionally, unnatural proteins and metabolites can have toxic effects when their production rate is high. After a couple of growth cycle, the worst seems unavoidable: the micro-organism that will be distributed will not be the right one. Not only this one doesn't produce nutrients, but it might not ferment the rice well or even be pathogenic.

These contamination events bring a lot of hassle for the manufacturer, so our design must provide solutions for making them as rare as possible.

Our approaches is based on two strategies:

• Reducing the fitness burden: To make our micro-organism more resistant to contamination, we need to design it so our modifications come with a minimal fitness cost.
• Identifying the contamination: If a contamination occurs, it is essential that it does not go unnoticed. Our design must allow the manufacturer to detect contamination, and check that what he is growing is exactly what he wants to grow.

Our differentiation system is inspired by the Brainbow system, initially developed for tracking the axons of neurons in mammalian's brain. We modified it so it becomes extendable.

This system is randomized on a single-cell level, so each cell produce one —and only one—, vitamin pathway. In most research work, metabolic engineering has been done only one target compound at a time, and little is known about what happens when production pathways are used simultaneously in the same cell (A).
Having one cell expressing only one pathway should theoretically preclude unexpected interactions between different pathways, thus making an extendable framework where every synthesis function is decoupled (B).
The different vitamin-producing pathways can be prototyped separately on a classical lab strain, and it is then easy to put them all together in the same chassis for a multi-functional organism.

Starting from this chassis, up to four metabolic pathways can be added by using the attB sequence as a landing pad. Like the Lox sites, this sequence comes from a bacteriophage: the PhiC31 phage uses it to integrate itself in the genome of the host. To insert a new sequence in this landing pad, all you need to do is build a plasmid with the matching "attP" site and express the PhiC31 integrase.

• attB: GTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCA
• attP: AGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGT

In summary, a new gene to be added in the system should have the following standard structure (A):

• An attP sequence different from the one that was used just before,
• A Lox sequence (Lox sequences should be added in the same order they come in the Lox Array),
• The operon to be expressed,
• An attB sequence, orthogonal to the attP used for integration,
• A selection system (not depicted here for clarity).

• GCGGGTGCCAGGGCGTGCCCTTGGGCTCCC for killing cells who have not integrated anything in the first attB version,
• GCGGGTGCCAGGGCGTGCCCCCGGGCTCCC, for the second attB version.

Now that the different genes have been added to the chassis, it is time to see it in action.

The CRE recombinase will cut the LoxP sites in the middle, remove the region in-between, and join the two remaining halves of LoxP sites together (Nagy 2000). This only occurs if the overlap sequence are exactly identical (Missirlis 2006). This means that, in the picture of the right, only LoxP sites of same colour would recombine. Given the configuration of this system, any LoxP recombination event would result in the loss of several other LoxP site, in a such way that further recombinations are not possible.