|
|
| Line 1: |
Line 1: |
| | {{Paris_Bettencourt/header}} | | {{Paris_Bettencourt/header}} |
| | {{Paris_Bettencourt/menu}} | | {{Paris_Bettencourt/menu}} |
| − | {{Paris_Bettencourt/continuityBanner}} | + | {{Paris_Bettencourt/phytaseBanner}} |
| − | | + | |
| | <html> | | <html> |
| − | <div class="column-left">
| |
| − | <p>In order to gain trust from the population, the technology should belong to everyone. In a way similar to the open-source software industry, people should be able to improve our project or create their own versions of it. This idea of openness is very common among the community of synthetic biologists, but a lot of pitfalls have to be overcome to make it a sustainable reality.</p>
| |
| − | <p>A parallel could be drawn with electronics in the 1960's, when computer programming was extremely low-level and belonged to the realm of academia. Since then, it has reached a way wider population, thanks to the creation of frameworks allowing for abstraction of the most technical parts. How could the same principles be applied to synthetic biology, in the context of metabolic engineering and vitamins production?</p>
| |
| − | <p>Even though a lot of lab strains designed for easier modification have been designed in the past, they usually have a very general purpose and biotechnology remains a matter of specialists where every modification has to be made from scratch. We imagined a repurposed organism made especially for the quick construction of these <em>self-replicative tiny factories</em>, that could be easily used by startups, community labs or just by enthusiasts. In the following section we discuss the constraints associated with it, and what such an organism could look like.</p>
| |
| − | </div>
| |
| | | | |
| − | <div class="column-right"> | + | <h2>Introduction</h2> |
| − | For the product to be usable, several specifications have to be taken into account:
| + | |
| − | <ul>
| + | |
| − | <li><b>It must be easily extendable:</b><br/>Our micro-organism should be a chassis allowing for quick addition of standard cassettes</li>
| + | |
| − | <li><b>It must be modular:</b><br/> The different metabolic pathways should be independant so they can be put together without going through tedious troubleshooting,</li>
| + | |
| − | <li><b>It must survive in the real world:</b><br/> To make our micro-organism more resistant to contamination, we need to design it so our modifications come with a minimal fitness cost.</li>
| + | |
| − | <li><b>It must be all-in-one:</b><br/> For people with limited equipment, having only one strain that does everything is a huge advantage, because only one bioreactor and one production line is needed. This makes it accessible to community labs or NGOs that would want to start producing their own version of our product.</li>
| + | |
| − | </ul>
| + | |
| − | </div>
| + | |
| − | <div style="clear:both"></div>
| + | |
| | | | |
| | | | |
| − | <h1 id="our-design">Our design</h1>
| |
| − |
| |
| − | <!-- Fitness burden -->
| |
| − |
| |
| − | <h2 id="from-the-lab-to-the-world">From the lab to the world</h2>
| |
| | | | |
| | <div class="column-left"> | | <div class="column-left"> |
| − | <p>For a biological product to leave the benches and actually reach the population, it's essential to foresee its life in the hands of the people who will cultivate it and make sure it stays alive all along. Our design must therefore provide strategies to create an durable, usable product. On paper, the plan is simple: the manufacturers grow the micro-organism, distribute it and save a little fraction to start a new culture with. This could in principle last forever, but in reality the universal rules of biology soon kick back in.</p> | + | <p> |
| − | <p>Let's consider the following scenario: a wild type organism sneaks into the incubator and starts to replicate along with the engineered organism. Our microbe cannot compete: this contaminant has been selected precisely for its ability to sneak into environments and replicate, during hundreds of years, while our microbe has the burden of producing tons of enzymes to make the precious vitamins. Additionally, unnatural proteins and metabolites can have toxic effects when their production rate is high. After a couple of growth cycle, the worst seems unavoidable: the micro-organism that will be distributed will not be the right one. Not only this one doesn't produce nutrients, but it might not ferment the rice well or even be pathogenic.</p> | + | Phytic acid (C<sub>6</sub>H<sub>18</sub>O<sub>24</sub>P<sub>6</sub>) is a molecule that inhibits the absorption of different cations like iron, zinc, copper, magnesium, calcium and cobalt in the intestine by forming insoluble salts around these elements. The removal of these minerals from food through this process can contribute to mineral deficiencies.</p> |
| − | | + | <p>Cereals, which are highly consumed in India, contain the highest levels of phytic acid.</p> |
| − | <p>These contamination events bring a lot of hassle for the manufacturer, so our design must provide solutions for making them as rare as possible.</p> | + | <p>Idli is mainly made of cereals. The majority of minerals present are not absorbed. |
| − | | + | We are looking for a solution to this bioavailability problem.</p> |
| − | <p>Our approaches is based on two strategies: | + | |
| − | <ul>
| + | |
| − | <li><b>Reducing the fitness burden:</b> To make our micro-organism more resistant to contamination, we need to design it so our modifications come with a minimal fitness cost.</li>
| + | |
| − | <li><b>Identifying the contamination:</b> If a contamination occurs, it is essential that it does not go unnoticed. Our design must allow the manufacturer to detect contamination, and check that what he is growing is exactly what he wants to grow.</li>
| + | |
| − | </ul>
| + | |
| − | </p> | + | |
| | </div> | | </div> |
| | | | |
| | <div class="column-right"> | | <div class="column-right"> |
| − | | + | <img src="https://static.igem.org/mediawiki/2015/b/bb/ParisBettencourt_phyticacid.jpg" width=300px"> |
| − | <p>It seems impossible to make a strain that fullfills its nutrient-producing functions while growing as fast as the wild type, so we found a workaround: the cells that people use are not the cells that people grow.<br/>
| + | <p class="legend"><b>Figure 1:</b> Phytic acid in complex with calcium, magnesium, zinc and iron</p> |
| − | | + | |
| − | We embedded a differentiation system into our organism, so the vitamin-producing pathways are only expressed after a recombination event. First, the cells that are grown are almost identical to the wild-type cells. Before distribution, the differentiation is induced and the cells start to produce vitamins in high quantity. The battle against contaminants is now a fair fight.</p>
| + | |
| − | | + | |
| − | <img src="https://static.igem.org/mediawiki/2015/8/88/PB_growth.png"/> | + | |
| − | <p class="caption">caption</p> | + | |
| − | | + | |
| | </div> | | </div> |
| | <div style="clear:both"></div> | | <div style="clear:both"></div> |
| | | | |
| − | <p>We protected our product against foreign organisms, but one threat remains: our organism's own mutants. If a mutation occurs in the active site of an enzyme, or in the promoter of an operon, the functionality of the organism might be impaired. How can we prevent our organism from mutating?</p>
| |
| | | | |
| − | <p>Fortunately, our friends at the Vanderbilt University iGEM team worked precisely on that problem this summer. We worked hand in hand with them to see what a real-life application of their invention would mean practically. They invented an algorithm to scan the sequences looking for regions that are likely to mutate, and proposed alternative versions of our sequences.<br/> | + | <br><h2>Phytase</h2> |
| − | As they worked on this project while we were working on ours, we obviously could not use their optimized sequences for our constructs. However, we relied on gene synthesis for a lot of parts, so it would not have been a problem to use the optimized sequences instead. Their algorithm is therefore a valuable tool for any synthetic biologist willing to create durable products, and we applaud their work.
| + | |
| − | </p> | + | |
| | | | |
| − | <!-- EXTENDABILITY -->
| |
| | | | |
| − | <h2>An extendable system</h2>
| |
| − | <div class="column-left" style="width: 35%">
| |
| − | <p>Our differentiation system is inspired by the Brainbow system, initially developed for tracking the axons of neurons in mammalian's brain. We modified it so it becomes extendable.</p>
| |
| − | <p>This system is randomized on a single-cell level, so each cell produce one —and only one—, vitamin pathway. In most research work, metabolic engineering has been done only one target compound at a time, and little is known about what happens when production pathways are used simultaneously in the same cell (<b>A</b>).<br/>
| |
| − | Having one cell expressing only one pathway should theoretically preclude unexpected interactions between different pathways, thus making an extendable framework where every synthesis function is decoupled (<b>B</b>).<br/>
| |
| − | The different vitamin-producing pathways can be prototyped separately on a classical lab strain, and it is then easy to put them all together in the same chassis for a multi-functional organism.</p>
| |
| − | </div>
| |
| − |
| |
| − | <div class="column-right" style="width: 60%">
| |
| − | <a href="https://static.igem.org/mediawiki/2015/9/98/PB_framework_construction.png">
| |
| − | <img src="https://static.igem.org/mediawiki/2015/9/98/PB_framework_construction.png"/>
| |
| − | </a>
| |
| − | </div>
| |
| − |
| |
| − | <div style="clear:both"></div>
| |
| − |
| |
| − |
| |
| − |
| |
| − | <h2 id="the-chassis">The chassis</h2>
| |
| − | Let us see how it works under the hood.<br/>
| |
| − | Before addition of any metabolic pathways, this is what our empty chassis would look like. The following cassette is integrated in the chromosome.
| |
| − | <br/>
| |
| − | <br/>
| |
| − | <a href="https://static.igem.org/mediawiki/2015/1/14/PB_chassis.png">
| |
| − | <img src="https://static.igem.org/mediawiki/2015/1/14/PB_chassis.png" style="width:100%"/>
| |
| − | </a>
| |
| − | <br/>
| |
| − | <p>All proteins' coding regions are preceded by a Ribosome Binding Site and followed by a transcription terminator.</p>
| |
| − | <br/>
| |
| − | <br/>
| |
| − |
| |
| − | <p><img src="https://static.igem.org/mediawiki/2015/e/ee/PB_1.png"/> <strong>Constitutive promoter:</strong> Thanks to this promoter, a RNA transcript of the cassette will be produced until the first terminator is reached.</p>
| |
| − | <p><img src="https://static.igem.org/mediawiki/2015/c/c8/PB_2.png"/> <strong>The Lox Array:</strong>
| |
| − | The original LoxP site comes from the phage P1.
| |
| − | When an enzyme called the <em>CRE recombinase</em> is expressed, all the DNA between two Lox sites is deleted. Each lox site is made of one <em>overlap region</em> (in bold) surrounded by two complementary <em>flanking regions</em>. The middle of the sequence can be modified, but two LoxP sites will recombine together only if the sequence is exactly identical for both (Richier 2015). The flanking regions cannot be mutated and determine the specificity for one recombination enzyme.</p>
| |
| − |
| |
| − | <p>Here are the four orthogonal Lox sites we used:
| |
| − | <ul style="font-size:13px">
| |
| − | <li><b>LoxP:</b> ATAACTTCGTATA<strong>ATGTATGC</strong>TATACGAAGTTAT</li>
| |
| − | <li><b>Lox2272:</b> ATAACTTCGTATA<strong>AAGTATCC</strong>TATACGAAGTTAT</li>
| |
| − | <li><b>LoxN:</b> ATAACTTCGTATA<strong>AGGTATAC</strong>TATACGAAGTTAT</li>
| |
| − | <li><b>Lox5171:</b> ATAACTTCGTATA<strong>ATGTGTAC</strong>TATACGAAGTTAT</li>
| |
| − | </ul>
| |
| − | </p>
| |
| − |
| |
| − | <p><img src="https://static.igem.org/mediawiki/2015/e/e6/PB_3.png"/> <strong>The ID gene: </strong>This gene is entirely optional but can be used as a barcode to identify the strain. This allows for quality control of what is inoculated when a new production culture is started.</p>
| |
| − |
| |
| − | <p><img src="https://static.igem.org/mediawiki/2015/8/8d/PB_4.png"/> <strong>The landing pad: </strong>
| |
| − | This part allows for easy integration of new gene cassettes into the system.
| |
| − |
| |
| − | <p><img src="https://static.igem.org/mediawiki/2015/9/9d/PB_5.png"/> <strong>CRE-recombinase: </strong>The CRE recombinase should be integrated in the chromosome as well, so we do not have to use an antibiotic for maintaining the plasmid. It has to be under the control of an inducible promoter. The expression of CRE will trigger the differentiation.</p>
| |
| | | | |
| − | <!-- LANDING PAD -->
| |
| | | | |
| − | <h2 id="landing-pads">The Landing Pad</h2>
| |
| | <div class="column-left"> | | <div class="column-left"> |
| − | <p>Starting from this chassis, up to four metabolic pathways can be added by using the attB sequence as a landing pad. Like the Lox sites, this sequence comes from a bacteriophage: the PhiC31 phage uses it to integrate itself in the genome of the host. To insert a new sequence in this landing pad, all you need to do is build a plasmid with the matching "attP" site and express the PhiC31 integrase. | + | <img src="https://static.igem.org/mediawiki/2015/8/8b/PariBettencourthhhvuhvuyvuyvfd-zmihigtd_%28%27e.png" width="700px"> |
| − | <ul style="font-size:13px">
| + | <p class="legend"><b>Figure 2:</b>Phytase hydrolyzes phytic acid.</p> |
| − | <li>attB: GTGCGGGTGCCAGGGCGTGCCC<strong>TT</strong>GGGCTCCCCGGGCGCGTACTCCA</li>
| + | |
| − | <li>attP: AGTGCCCCAACTGGGGTAACCT<strong>TT</strong>GAGTTCTCTCAGTTGGGGGCGT</li>
| + | |
| − | </ul>
| + | |
| − | When inserting something in the landing pad, a new landing pad should be added for subsequent integration. This landing pad should be orthogonal to the first one to avoid multiple successive integrations. The same integrase can be used, the central <strong>TT</strong> just has to be replaced by <strong>CC</strong> to make the two sites orthogonal.</p>
| + | |
| − | <p>In summary, a new gene to be added in the system should have the following standard structure (<b>A</b>):
| + | |
| − | <ul>
| + | |
| − | <li>An attP sequence different from the one that was used just before,</li>
| + | |
| − | <li>A Lox sequence (Lox sequences should be added in the same order they come in the Lox Array),</li>
| + | |
| − | <li>The operon to be expressed,</li>
| + | |
| − | <li>An attB sequence, orthogonal to the attP used for integration,</li>
| + | |
| − | <li>A selection system (not depicted here for clarity).</li>
| + | |
| − | </ul>
| + | |
| − | When the phage PhiC31 integrase is expressed, this plasmid will be integrated in the locus (<b>B</b>). The CRISPR-Cas9 system from <em>S. pyogenes</em> should work well for selecting the cells who integrated the plasmid(Jiang, Bikard 2013), as the attB contains the protospacer adjacent motif "NGG" next to the two central bases (Mojica 2009). It is therefore possible to kill the cells who still have an intact attB site, just by using CRISPR spacers targeting the following sequences:
| + | |
| − | <ul style="font-size:13px"> | + | |
| − | <li>GCGGGTGCCAGGGCGTGCCCTTGGGCTCCC for killing cells who have not integrated anything in the first attB version,</li>
| + | |
| − | <li>GCGGGTGCCAGGGCGTGCCCCCGGGCTCCC, for the second attB version.</li>
| + | |
| − | </ul>
| + | |
| − | It has the advantage of leaving no scar, thus reducing the number of recombination sites present in the locus.<br/>
| + | |
| − | After integration, the new cassette becomes a new part of the system (<b>C</b>).
| + | |
| − | </p> | + | |
| | </div> | | </div> |
| | | | |
| | <div class="column-right"> | | <div class="column-right"> |
| − | <a href="https://static.igem.org/mediawiki/2015/7/75/PB_landingpad.png"><img src="https://static.igem.org/mediawiki/2015/7/75/PB_landingpad.png" style="width:90%"/></a> | + | <p>Phytase could be a solution to this problem. Phytase is an enzyme which hydrolyzes phytates created by phytic acid when it is complexed to a mineral. Thanks to this, the cations will be liberated and may be absorbed by the organism.</p> |
| − | <br/>
| + | |
| − | </div>
| + | |
| − | <div style="clear:both"></div>
| + | |
| | | | |
| − | <!--DIVISION OF LABOUR --> | + | <p>Phytase is naturally produced by <i>Saccharomyces cerevisiae</i> (Veide, 2006). This yeast contains negative regulator genes, and because of it, the phytase is produced in very small quantities.</p> |
| | | | |
| − | <h2 id="division-of-labour">Division of labour</h2>
| + | <p>The negative regulators are produced by two important genes in <i>Saccharomyces cerevisiae</i> : PHO80 on chromosome 15 (325.249pb - 326.130pb) and PHO85 on chomosome 16 (492.018pb - 493.037pb). With the deletion of one or both of these genes, the phytase may be overproduced.</p> |
| − | <div class="column-left">
| + | |
| − | <p>Now that the different genes have been added to the chassis, it is time to see it in action.</p> | + | |
| − | <p>The CRE recombinase will cut the LoxP sites in the middle, remove the region in-between, and join the two remaining halves of LoxP sites together (Nagy 2000). This only occurs if the overlap sequence are exactly identical (Missirlis 2006). This means that, in the picture of the right, only LoxP sites of same colour would recombine. Given the configuration of this system, any LoxP recombination event would result in the loss of several other LoxP site, in a such way that further recombinations are not possible. The pair of LoxP sites that undergo recombination is therefore chosen randomly by each cell.</p> | + | |
| − | <p>Depending on which region is excised, one random coding region settles next to the promoter and starts to be expressed. For a chassis containing four different operons, the mother cells differentiates in four different daughter cells, each of them expressing one operon.</p>
| + | |
| − | <p>Even if the chassis is not completely filled, it still works: the number of different daughter cells is always equal to the number of inserted cassettes, and the probability of each is adjusted accordingly.</p>
| + | |
| − | </div>
| + | |
| − | <div class="column-right">
| + | |
| − | <a href="https://static.igem.org/mediawiki/2015/6/65/PB_brainbow.png">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2015/6/65/PB_brainbow.png" style="width:100%" align="middle"/>
| + | |
| − | </a>
| + | |
| − | <p class="caption">https://static.igem.org/mediawiki/2015/6/65/PB_brainbow.png</p>
| + | |
| | </div> | | </div> |
| | <div style="clear:both"></div> | | <div style="clear:both"></div> |
| | | | |
| − | <h3>How to induce the differentiation?</h3> | + | <br><h2>Design</h2> |
| | | | |
| − | <h4>Chemical<h4>
| + | <p>To test our experiment, we used a colormetric kit to measure the quantity of phytic acid .</p> |
| − | <h4>Heat</h4>
| + | <img src="https://static.igem.org/mediawiki/2015/a/a0/ParisBettencourt_SchemaprojetGJGZDB.jpeg" width="1000px"> |
| − | <h4>Light</h4>
| + | |
| − | <h4>Constitutive</h4>
| + | |
| − | <p>leakiness</p> | + | |
| − | model
| + | |
| − | <a href="https://2015.igem.org/Team:Paris_Bettencourt/Modeling">learn more about the model</a>. | + | |
| | | | |
| − | <p>decoupling the different metabolic pathways </p> | + | <br><h1>Results</h1> |
| | | | |
| | | | |
| | + | We have not result, but if we had more times, we may continue experiments to have more concluding results. The results we have already leads us to believe that there is much chance that his works. |
| | | | |
| − | <h1 id="results">Results</> | + | <br><h2>Bibliography</h2> |
| − | <h2 id="construction-of-the-system">Construction of the system</h2> | + | |
| − | <p>We succesfully assembled a prototype version of this system in the model bacteria <em>Escherichia coli</em>. The genes involved in vitamin production are replaced with fluorescent proteins, allowing for easy monitoring of their production. Our construct contains mCherry as a reporter gene, and two other fluorescent proteins to mimick pathways operons. It also has a phage PhiC31 integration site for subsequent addition of new genes.</p>
| + | |
| − | <div class="figure">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2015/8/8f/PB_colibow_sequence.png" title="https://static.igem.org/mediawiki/2015/8/8f/PB_colibow_sequence.png" alt="https://static.igem.org/mediawiki/2015/8/8f/PB_colibow_sequence.png" />
| + | |
| − | <p class="caption">https://static.igem.org/mediawiki/2015/8/8f/PB_colibow_sequence.png</p>
| + | |
| − | </div>
| + | |
| − | <p>This cassette was constructed by Gibson Assembly and assembled in a self-integrating plasmid vector which integrates in the site of the phage HK022 in <em>E. coli</em>'s chromosome. This plasmid was electroporated in the bacteria and the phage HK022 integrase was induced.</p>
| + | |
| − | <h3 id="integration-in-the-bacterial-cells">Integration in the bacterial cells</h3>
| + | |
| − | <p>To check that the cassette has correctly been integrated in the right locus, we performed an analytical PCR on the whole genome of the transformants, with a set of four primers mixed altogether. <img src="https://static.igem.org/mediawiki/2015/a/a7/PB_colibow_integrated.png" title="fig:https://static.igem.org/mediawiki/2015/a/a7/PB_colibow_integrated.png" alt="https://static.igem.org/mediawiki/2015/a/a7/PB_colibow_integrated.png" /></p>
| + | |
| − | <h3 id="integrity-of-the-cassette">Integrity of the cassette</h3>
| + | |
| − | <p>fluorescent proteins are present <img src="https://static.igem.org/mediawiki/2015/5/5b/PB_colibow_proteins.png" title="fig:https://static.igem.org/mediawiki/2015/5/5b/PB_colibow_proteins.png" alt="https://static.igem.org/mediawiki/2015/5/5b/PB_colibow_proteins.png" /></p>
| + | |
| − | <h3 id="sequencing-of-the-lox-array">Sequencing of the Lox Array</h3>
| + | |
| − | <p>To investigate whether unexpected recombination occured within the LoxP sites due to homologous recombination, we performed sequencing on the first part of the integrated cassette, where the Lox Array is. This way we could make sure that it was still intact.</p>
| + | |
| − | <h2 id="function-of-the-promoter">Function of the promoter</h2>
| + | |
| − | <p><img src="https://static.igem.org/mediawiki/2015/9/95/PB_lox_charac.png" title="fig:https://static.igem.org/mediawiki/2015/9/95/PB_lox_charac.png" alt="https://static.igem.org/mediawiki/2015/9/95/PB_lox_charac.png" /> BBa_K1678005</p>
| + | |
| − | <p>The LoxP array does not theoretically interfere with translation, as in prokaryotes the 30S subunit of the ribosome binds directly to the ribosome binding site even if it is not right at the beginning of the mRNA transcript. It can however interfere with the transcription. During the transcription, the RNA polymerase has to go through the LoxP array, which is made of repetitive sequences that are likely to form a hairpin. We show that this has an impact on the transcription efficiency (Mann-Whitney test, p-value < 10<sup>-6</sup>), as the amount of protein is reduced on average by 9%. However, it still allows for strong protein expression and the 91% of RNA polymerases that get through should be more than enough for our design.</p>
| + | |
| − | <p>We have also sequenced it.</p>
| + | |
| − | <p><img src="https://static.igem.org/mediawiki/2015/b/be/PB_colibow_fluorescence.png" title="fig:https://static.igem.org/mediawiki/2015/b/be/PB_colibow_fluorescence.png" alt="https://static.igem.org/mediawiki/2015/b/be/PB_colibow_fluorescence.png" /> When integrated (Mann-Whitney test, p-value < 10<sup>-6</sup>)</p>
| + | |
| − | <p>suitability for quality control DIlambda</p>
| + | |
| − | <h2 id="induction-of-the-differentiation">Induction of the differentiation</h2>
| + | |
| − | <div class="figure">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2015/c/c1/PB_empty.png" title="https://static.igem.org/mediawiki/2015/c/c1/PB_empty.png" alt="https://static.igem.org/mediawiki/2015/c/c1/PB_empty.png" />
| + | |
| − | <p class="caption">https://static.igem.org/mediawiki/2015/c/c1/PB_empty.png</p>
| + | |
| − | </div>
| + | |
| − | <h2 id="effects-on-growth">Effects on growth</h2>
| + | |
| − | <h1 id="outlook">Outlook</h1>
| + | |
| − | <p>link</p>
| + | |
| − | | + | |
| − | <h1>Litterature</h1>
| + | |
| − | <ul>
| + | |
| − | <li>Mojica et al., 2009, "Short motif sequences determine the targets of the prokaryotic CRISPR defence system". Microbiology 155 (Pt 3): 733–740.</li>
| + | |
| − | <li>Jiang, Bikard et al., 2013. "RNA-guided editing of bacterial genomes using CRISPR-Cas systems", Nat Biotechnol. 2013 Mar;31(3):233-9.</li>
| + | |
| − | <li>Nagy et al., 2000. "Cre recombinase: the universal reagent for genome tailoring". Genesis 26 (2): 99–109. </li>
| + | |
| − | <li>Missirlis et al., 2006. "A high-throughput screen identifying sequence and promiscuity characteristics of the loxP spacer region in Cre-mediated recombination". BMC Genomics 7: 73. </li>
| + | |
| − | </ul>
| + | |
| − | | + | |
| − | <h1>Attribution</h1>
| + | |
| − | This project was designed and accomplished by Antoine Vigouroux in consultation with Jason Bland and Ihab Boulas.
| + | |
| | | | |
| − | Most of the strains (DH5alpha, Top10, NEB turbo, Pir116) were kindly provided by Inserm U1001. Plasmids pFHC2938 and pMEV250 were provided by Jason Bland and Aleksandra Nivia at Didier Mazel's lab at Institut Pasteur. Plasmids pL1F2 and pR6K-shortened were provided by Antoine Decrulle and Ihab Boulas at Inserm U1001. The pIT5-KH vector was provided by Lun Cui at David Bikard's lab at Institut Pasteur.
| + | Veide, J. & Andlid, T. Improved extracellular phytase activity in Saccharomyces cerevisiae by modifications in the PHO system. International Journal of Food Microbiology 108, 60-67 (2006). |
| | | | |
| − | Special thanks to all the people who gave me an hand during this project, and all the Paris Bettencourt team for making it so much fun.
| |
| | </html> | | </html> |
| | {{Paris_Bettencourt/footer}} | | {{Paris_Bettencourt/footer}} |
