Difference between revisions of "Team:Hamburg/Composite Part"
Line 32: | Line 32: | ||
<p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font><font color="cyan">ttgacggctagctcagtcctaggtacagtgctagc</font><font color="red">TACTAGAG</font>GGCCGGGGGACGGACTGGGA<font color="orange">TACTAGTAGCGGCCGCTGCAG</font></FONT></p> | <p><FONT FACE="courier"><font color="orange">GAATTCGCGGCCGCTTCTAGAG</font><font color="cyan">ttgacggctagctcagtcctaggtacagtgctagc</font><font color="red">TACTAGAG</font>GGCCGGGGGACGGACTGGGA<font color="orange">TACTAGTAGCGGCCGCTGCAG</font></FONT></p> | ||
<p>3'</p> | <p>3'</p> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
<figure class="fig1"> | <figure class="fig1"> |
Revision as of 17:07, 18 September 2015
Composite Parts
constitutive promoter and miRNA
Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as important intermediate step. It is a composite part of our basic part miRNA2911 and a standard promotor BBa_J23100 (figure 2).
![](https://static.igem.org/mediawiki/2015/b/b2/Hamburg_parts6.jpg)
BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR.
![](https://static.igem.org/mediawiki/2015/b/b2/Hamburg_parts6.jpg)
Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)
5'
GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG
3'
![](https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg)
![](https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg)
Note
In order to be considered for the Best New Composite Part award, you must fill out this page. Please give links to the Registry entries for the Composite parts you have made. Please see the Registry's Help:Parts page for more information on part types.
A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. BBa_I13507 is an example of a composite part, consisting of an RBS, a protein coding region for a red fluorescent protein, and a terminator.
New composite BioBrick devices can be made by combining existing BioBrick Parts (like Inverters, Amplifiers, Smell Generators, Protein Balloon Generators, Senders, Receivers, Actuators, and so on).